Commercialized Diagnostic Products for Novel Coronavirus (COVID-19) in India

The importance of diagnostic market increased significantly amid the coronavirus pandemic outbreak, by providing a new potential growth opportunity pocket which enables the diagnostic companies to launch and commercialized new product in the Indian market to save the lives of thousand people, by ramping up the diagnosis process through identification of the virus and treatment. The major drivers are lifestyle diseases rising, improving per capita, increasing awareness, and increasing payer coverage. Apart from it, they are certain influencing factors such as accessibility, lack of specialists, lack of standardization & affordability still a concern.

Out of many private companies, recently the government had allowed two private companies include Indian company MyLab and German firm Altona Diagnostics – to supply COVID-19 test kits to both government as well as private testing laboratories in India. In addition, two south Korean firms, Seegene and SD Biosensor have received government approval to supply RT-PCR based Novel Coronavirus (COVID-19) diagnostic kits in India.

The government has also approved 12 rapid antibody test kits for COVID-19 diagnosis companies such as BioMednomics (USA), Getein Biotech (China), Sensing Self Ltd (Singapore), Hangzhou Biotest Biotech (China), AmonMed Biotechnology Co (China), Beijing Tigsun Diagnostics Co Ltd (China), Biomaxima (Poland), CTK Biotech (USA), Hunan Lituo Biotechnology Co (China), Vivacheck Lab (China) and Wondfo (China). While, The rapid antibody test facilitate result within 30 minutes, thereby providing additional benefits. The test comes positive after 7 to 10 days of infection. While a positive test indicates exposure to COVID-19, negative does not rule out the infection.

There are several companies issued a CDSCO license in the Indian market such as Altona Diagnostics, MY LABS, Roche & Seegene, etc.

Altona Diagnostics: RealStar SARS-CoV-2 RT-PCR Kits

Altona Diagnostics, RealStar SARS-CoV-2 RT-PCR Kits (1.0 and U.S versions), is a reagent system, based on real-time PCR technology, for the qualitative detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These tests can be run in parallel: RealStar® Influenza Screen & Type RT-PCR Kit 4.0.etc

Mylab Discovery Solutions Pvt Ltd: PathoDetect COVID-19 Qualitative PCR ‘Made in India’ test kits

Pune based Mylab Discovery Solutions Pvt Ltd developed PathoDetect COVID-19 Qualitative PCR ‘Made in India’ test kits are capable of diagnosing a patient in two-and-a-half hours, unlike the imported kits, which currently take up to seven hours. The kits have reportedly been developed in a record time of six weeks and will reduce the cost of testing to a fourth of the current cost. It also the first Indian diagnostic kit approved by the ICMR against COVID-19.

Allplex: 2019-nCoV Assay

Allplex 2019-nCoV Assay is a multiplex Real-time PCR assay for simultaneous detection of 3 target genes of SARS-CoV-2 in a single tube. The assay is designed to detect RdRP and N genes specific for SARS-CoV-2, and E gene for all of Sarbecovirus including SARS-CoV-2. It shows PCR with high sensitivity and specificity by giving results within 1 hour and 50 minutes after extraction. It has also inserted an automatic data analyzer and LIS interlocking with Seegene Viewer. It also gives quick response and proper treatment provided by accurate test results.

Genesig: Real-Time PCR COVID-19

Genesig Real-Time PCR COVID-19 (CE) is CE-IVD marked and intended for in vitro diagnostic use in Europe.  This is a rapid kit detection and exclusive to the COVID-19 strain, however not involved in the detection of other related coronavirus strains. It has high priming efficiency and a highly specific detection profile. Besides, Lyophilised components for ambient shipping. It also involved in driving accurate controls to confirm extraction and assay validity.

Roche Diagnostics: Cobas SARS CoV-2 Diagnostic Test Kit

Roche Diagnostics India has received the license from the country’s drug regulator DCGI for its ‘cobas SARS CoV-2’ diagnostic test kit, making it the first private firm to get permission to conduct coronavirus tests Since, the NIV has tested 14 privately-made kits and recommended three kits made Atona Diagnostics, MyLab, and Seegene for CDSCO license.

Commercialized Diagnostic Products

CompanyDiagnostic KitProduct Description
Altona diagnosticRealStar SARS-CoV- 2 RT-PCR kit 1.0Reagent system, based on real-time PCR technology, for the qualitative detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These tests can be run in parallel  
MY LABPatho DetectPathoDetect COVID-19 Qualitative PCR kit would cost just around one-fourth of the current procurement cost.  
BGIReal Time Fluorescent RT-PCR kit for detecting 2019-nCoVReagents commercially distributed as a kit to labs Can only be run in high complexity labs
Krishgen BiosystemSARS-CoV-2 Coronavirus Real-Time RT-PCR (RT-Qpcr) Detection kit v1Uses Taqman probes. Taqman Probes are widely used RT-PCR assay because of its sensitivity and specificity with dual quenchers for higher accuracy. With 2/3 Primer/Probe option  
ABITaqMan 2019-nCov Control kit v1TaqMan 2019-nCoV Control Kit v1 is a synthetic positive control that contains target sequences for each of the assays included in the TaqMan 2019-nCoV Assay Kit v1 (Cat. No. A47532). The control includes synthetic DNA target sequences for three SARS-CoV-2 genes (ORF1ab, S protein, and N protein) and the human RNase P RPPH1 gene.

HIMEDIAHi-PCR Coronavirus (CoVID-19) Probe PCR kitTo perform PCR on various DNA templates for numerous downstream applications. It also contains all necessary components including HiMedia’s ultra-efficient Taq Polymerase, dNTP mixture, and MgCl2 for reproducible PCR results.   
HUWELQuantiplus Coronavirus (2019nCoV) Detection kitThe kit has a synthetic gene cloned in a plasmid as a positive control. The primers set is cross-verified for specificity with several RNA and DNA viruses and bacteria  
IIT-DELHISYBR Green based one step QRT-PCRFirst probe-free assay for COVID-19 approved by the ICMR and it will be useful for specific and affordable high throughput testing. It can easily be scaled up as it does not require fluorescent probes.  Targeting large-scale deployment of the kit at affordable prices with suitable industrial partners as soon as possible.  
KILPEST (BLACKBIO) TRUPCRReal-Time PCR Test is a molecular detection test that screens and detects Covid-19 specific genes and is confirmatory.  
GenesigCoronavirus (COVID-19) genesig Real Time PC   R AssayRapid detection and exclusive to the COVID-19 strain Does not detect other related coronavirus strains High priming efficiency  
Roche  LightMix Modular SARS and Wuhan CoV E geneE_Sarbeco_F1 (Oligonucleotide ID) Contains ACAGGTACGTTAATAGTTAATAGCGT (5’-3’ sequence ) by using use 400 nM per reaction
Roche  LightMix Modular SARS and Wuhan CoV N geneN_Sarbeco_F1 (Oligonucleotide ID) Contains CACATTGGCACCCGCAATC (5’-3’ sequence ) by using use 600 nM per reaction
Roche  LightMix Modular Wuhan RdRp geneDetect Wuhan 2019 SARS-like CoV pneumonia virus Sensitivity is 3.8 copies per reaction (95% CI: 2.7–7.6) Lot release min 10 copies  
SeegeneAllplex 2019-nCoV assayMultiplex real-time PCR assay for simultaneous detection of 3 target genes of SARS-CoV-2 in a single tube Results within 1 hour and 50 minutes after extraction  

Emerging Diagnostic Test Products For Novel Coronavirus (COVID-19)

Over the last few months, the coronavirus outbreak has spread to various countries such as China, South Korea, Italy, Iran, Japan, Singapore, Hong Kong, the United States, and other countries. It has endangered thousands of lives in a short span of time. Hence, several diagnostic companies have been focused on the development of promising diagnostic test products to expedite the diagnosis process as quickly as possible to save the lives of people.

The pipeline landscape of the coronavirus detection is robust with the involvement of several diagnostic test products such as PANDAA qDx SARS-CoV-2, RabWiz Ultra-Sensitive COIV-19 Viral Antigen Test Kit (ELISA) & AiroStotleCV19 (Breath VOCs), etc. Below is a list of the company and its product descriptions and key information for all the emerging diagnostic test products

Canary Health Technologies: AiroStotleCV19 (Breath VOCs)

Canary Health Technologies has developed AiroStotleCV19 (Breath VOCs), a highly sensitive, specific, non-invasive and cost-effective test using VOCs analysis as a result of oxidative stress offers a potentially powerful new approach to early diagnosis COVID-19

Aurora Biomed Inc.: SARS-COV-2 Detection Kit

SARS-COV-2 Detection Kit for the VERSA Viral Detection workstation involved in targeting genes includes ORF1ab and N gene and produces 24 tests per kit. It shows a detection limit in 200copies per mL. However, positive and negative test control is also used to monitor the test accuracy.

GNA Biosolutions GmbH: SARS-CoV-2 Detection Kit

GNA Biosolutions GmbH has developed the SARS-CoV-2 Detection Kit on a portable PCA Analyzer which comprised of an instrument and disposable test chips. The test would run on the neo system whichamplifies and detects genetic material and can be used to test eight samples at a time. Moreover, it can also provide analysis within 15-25 minutes.

FluroTest LLC: CompleTest Platform Technology

FluroTest LLC uses the CompleTest platform technology to test for a range of viruses including COVID-19, as well as accurately determining the viral load.  Additionally, FluroTest ‘s technology can be adapted to allow for the detection of specific anti-SARS-CoV-2 human antibodies in blood samples, potentially confirming the development of immunity. Once developed, both tests would be administered at point-of-collection with results expected to be available in less than 15 minutes.

Attomarker Ltd: Immuno-Kinetic Assay for Covid-19

Attomarker Ltd has Developed the Quantitative Immuno-kinetic assay for Covid-19 IgG+IgM+IgA for a multiantigen panel with CRP (automated) which relies on detecting virus RNA in a swab sample from the patient’s throat or nose. It is a Portable device Attomarker Liscar which comprised of 4 bench-top instruments, each providing results in just ten minutes.

Emerging Diagnostic Products Landscape for Novel Coronavirus (COVID-19)

Company Name/ SponsorsProduct Test TypeProduct Description
Academia Sinica  Anti-SARS-CoV-2 nucleocapsid protein human IgM/IgG rapid detection kitSimple detection procedure Only 15- 20 minutes
Access Bio Korea, Inc. CareStart COVID-19 IgM/IgGThe device is designed to amplify a total of two unique target genes of SARS-CoV-2 to improved sensitivity and with its high sensitivity
AIVD Biotech Inc. COVID-19 IgG/IgM Rapid Test (colloidal gold-based)OEM onlyResults within 10-15 min
Aldatu Biosciences PANDAA qDx SARS-CoV-2 Real-time PCR detection of COVID-19 Disease
Ativa Medical Ativa Enhanced ScreenMiniaturized low-cost diagnostic testsImmediate lab-quality results
Attomarker Ltd Quantitative Immuno-kinetic assay for Covid-19 IgG+IgM+IgA for a multiantigen panel with CRP (automated) It relies on detecting virus RNA in a swab sample from the patient’s throat or nosePortable Attomarker Liscar  bench-top instrument, each providing results in just ten minute
Aura Biotechnologies Ltd 
Quick COVID-19 Colorimetric LAMP PCRFast and simple yet accurate detection for coronavirusTakes 30 minutes’ assay
Aurora Biomed Inc. SARS-COV-2 Detection Kit for the VERSA Viral Detection workstation Target genes: ORF1ab and N gene200 copies per mL detection limitPositive and negative controls to monitor test accuracy24 tests per kit
Beijing Infervision Technology Co. Ltd InferRead CT PneumoniaCT-AI Based model is efficient and reliable
Canary Health Technologies AiroStotleCV19 (Breath VOCs)A highly sensitive, specific, non-invasive and cost-effective test using VOCs analysis as a result of oxidative stress offers a potentially powerful new approach to early diagnosis COVID-19
DNA Software, Inc. Upper Respiratory Virus Panel, multiplex PCR, COVID-19, Influenza A BAutomated consensus design of multiple variants of DNA or RNA targets
FemtoDx COVID-19 Antibody TestAt Home testThe test will take under 5 minutesEasy to use the device
FemtoDx COVID-19 Rapid Home Nucleic Acid Test At Home testThe test will take under 5 minutesEasy to use the device
FluroTest LLC Complete TestCompleTest platform technology to test for a range of viruses including COVID-19, as well as accurately determining the viral load.
Fluxergy LLCFluxergy Sample-to-Answer SARS-CoV-2 RT-PCRA point-of-use device capable of comprehensive laboratory
testing
Genedrive plc Genedrive 96 SARS-CoV-2 Kit The assay combines Genedrive’s PCR chemistry integrated with Cytiva’s LyoStable stabilization technology.
GNA Biosolutions GmbH SARS-CoV-2 Detection Kit on portable PCA AnalyzerThe system amplifies and detects genetic material and can be used to test eight samples at a timeProvide analysis within 15-25 minutes  
AB Diagnostic Systems GmbH abia SARS-CoV-2 AbThe world’s easiest to use a range of diagnostic kits for HIV, hepatitis A, B, C, D, E infections, SARS-CoV-2 (COVID-19), prenatal diagnostics (TORCH), hormones (thyroid, fertility), tumor markers and moreCompletely recyclable
Abwiz BioRabWiz Ultra Sensitive COIV-19 Viral Antigen Test Kit (ELISA)It can play a critical role in the development of next-generation COVID-19 diagnostic toolsHighly-specific SARS-CoV-2 monoclonal antibodies

Incorrect recommendations or information regarding the Novel Coronavirus (COVID-19)

Incorrect Recommendations or Information Regarding the Novel Coronavirus (COVID-19)

Now-a-days the several recommendations and information regarding the (COVID-19) coronavirus are being shared on social media including Facebook, WhatsApp, twitters, and others. A wide majority of these tips and information is based on false or unsubstantiated claims.

The Geneva health authorities have provided the list of the incorrect recommendations or information regarding the (COVID-19) coronavirus being shared. Here are the key list of these incorrect recommendations or information as follows:

Does a person without symptoms carrying the coronavirus is contagious?

According to the studies, people without symptoms are not the potential sources of contamination. The coronavirus infection spread mainly through respiratory droplets expelled by the people who cough. Sick people are most contagious when they are most symptomatic. There is no sufficient studies regarding the whether asymptomatic people infected with the new coronavirus are contagious or how long they are contagious before symptoms appear.

Will the virus die if exposed to temperatures of 26-27°C?

There are not any studies confirming that the climate or temperatures have an impact on the spread of coronavirus. Thus, it is impossible to say that spring or summer heat can literally kill a virus.

Does hot liquid neutralizes the virus?

It has been observed that drinking hot water or the frequency of water consumption has no effect on the coronavirus. It is not necessary to change the temperature of the water you drink. It is essential to drink water not just for killing the coronavirus.

Can coronavirus survive on inert surfaces for about 6 to 12 hours?

Various studies have shown that the coronaviruses can exist on surfaces from up to a few hours to several days depending on the different parameters such as surface type, temperature or humidity.

Does eating more ginger, garlic, pepper, etc. protects against coronavirus?

Eating ginger, garlic, pepper does not fight specifically against the coronavirus. These foods have virtues for the body.

One must hold your breath to find out if you are infected with the coronavirus. Holding one’s breath for more than 10 seconds without coughing, discomfort, congestion or tightness would prove that there is no fibrosis in the lungs and therefore no infection.

There is no scientific evidence to support this assertion. Only a laboratory test can confirm infection with the new coronavirus.

Does drinking water and gargling cure COVID-19?

Saltwater is effective in relieving the sore throat. People are advised to drink water to stay hydrated when they are sick with the flu or the novel coronavirus. Drinking does not eliminate the coronavirus in any way.

Dogs and cats can transmit the coronavirus?

There are not any studies demonstrating the transmission of the coronavirus through the dogs and cats.

Rinsing the nose regularly protects against coronavirus infection?

There are not any studies demonstrating the rinsing your nose with a saline solution protects against coronavirus infection.

Does coronavirus only affect vulnerable people?

Coronavirus can affect the people of any age-group. Elderly people and people with pre-existing conditions such as asthma, diabetes, chronic lung disease, cancer, heart disease, etc are at high risk of developing the coronavirus infection. Hence, people are advised to take measures to protect themselves from the virus through social distance of at least 2 meters, regular and meticulous hand washing, good respiratory hygiene, etc.

Are antibiotics effective in preventing and treating coronavirus infection?

Antibiotics do not work against viruses but are effective against only bacteria. The antibiotics should not be used as a means of prevention or treatment. If one is hospitalized for infection with CoV-2-CASR then one can receive antibiotics as the bacterial co-infection is possible.

Can Chloroquine cures COVID-19?

There is no drug effective for the treatment of COVID-19. Some treatments are tested in numerous research protocols worldwide. Hence, Chloroquine treatment is currently reserved for patients in hospital settings or as part of a research protocol.

Are fabric masks an efficient substitute for surgical masks?

Fabric masks not efficient substitutes for surgical masks. In fact, surgical masks are the only masks where there is scientific data regarding filtration efficiency and airtightness.  Fabric masks or other hand-made masks do not provide the bearer with any proven protection against coronavirus. Further, it is recommended that medical masks must be worn only by health staff members. FFP2 masks are required only if the presence of COVID-19 is suspected in a patient and if a high level of aerosol formation is expected during a medical procedure. Healthy people should not wear medical masks or surgical masks in the public. Healthy people must prefer fabric masks in the public.

Novel Coronavirus (COVID-19) Preventive Measures

Novel Coronavirus (COVID-19) Preventive Measures

The novel Coronavirus (COVID2019) outbreak identified in China is causing global concern. It has spread to more than 200 countries worldwide. According to the World Health Organization (WHO)’s live report, there are more than 13,00,000 confirmed cases of the novel Coronavirus (COVID-19) outbreak. Approximately, 74,306 number of people died due to the novel Coronavirus. The United States accounts for highest cases (363,321) followed by Spain (135,032), Italy (132,547), Germany (99,225) China (83,157) and France (73,488).

There are no specific vaccines or treatments for COVID-19. Several clinical trials are undergoing for evaluating the potential treatments. Hence, it is essential to prevent Coronavirus infection and slowing the rate of transmission.

“Prevention is better than cure”

Preventive measures for Coronavirus are as follows:

  • Wash Your Hands

Wash your hands regularly with soap and water, or clean them with alcohol-based hand rub

  • Avoid Close Contact

Maintain at least 1 metre distance with the people coughing or sneezing

  • Social Distancing & Stay Home

Stay home and Practice physical distancing by avoiding unnecessary travel and staying away from large groups of people

  • Wear Facemask

Wear a facemask if you are sick

  • Cook Food

Cook food thoroughly

  • Elbow Coughing

Use Elbow to cough into it

  • Cleanliness

Clean frequently touch surfaces daily

  • Cover coughs and sneezes

Cover your mouth and nose when coughing or sneezing

  • Avoid touching surfaces

Avoid touching doorknobs and banisters

World Health Day

World Health Day

Every year, World Health Day is celebrated on April 7 under the auspices of the World Health Organization (WHO), as well as other related organizations.

This year, World Health Day i.e. April 7, 2020, will focus on the vital role played by nurses and midwives in providing healthcare worldwide. It will highlight the current status of nursing across the globe. WHO and its partners would make a series of recommendations to strengthen the nursing and midwifery workforce.

This world health day, we pay tribute to the contribution of nurses and midwives for their vital role in keeping the world healthy. Nurses and other health workers who are at the frontlines in providing the treatment and care to patients suffering from novel coronavirus (COVID-19) outbreak by putting their own health at risk to protect the community.

We are thankful for their commitment and hard work for saving lives!

Coronavirus Outbreak

Coronavirus Outbreak

Coronaviruses Description

Coronaviruses are a family of viruses that lead to respiratory illness, including the Middle East respiratory syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). It is common in many different species of animals, including camels, cattle, cats, and bats. Rarely, animal coronaviruses can infect people and then spread between people such as with MERS-CoV, SARS-CoV, and now with this new virus (named SARS-CoV-2). The SARS-CoV-2 virus is a betacoronavirus, like MERS-CoV and SARS-CoV.  All three of these viruses have their origins in bats. Similar infections are caused by human alpha and beta coronaviruses such as 229E, NL63, OC43, and HKU1.

The symptoms associated with coronavirus are the common cold, such as running nose, headache, cough, fever, and sore throat. Viruses can spread from human contact with animals. According to the World Health Organisation (WHO), scientists think MERS started in camels. Officials do not yet know what animal may have caused the current outbreak in Wuhan.

Human-to-human transmission has been confirmed for the Wuhan coronavirus, but depending on how virulent the virus is, a cough, sneeze or handshake could cause exposure. The virus can also be transmitted by touching something an infected person has touched and then touching your mouth, nose or eyes. Caregivers can sometimes be exposed by handling a patient’s waste, according to the Centers for Disease Control and Prevention (CDC). Furthermore, SARS and MERS were largely transmitted inside hospitals. Some people are also considered to be “super spreaders.”

Current Scenario

The novel coronavirus (COVID-19) was first discovered in Wuhan, China in December 2019, since then, it has affected more than 400,000 people and caused 18,440 deaths according to the World Health Organization (WHO)’s recent situation report.

The seafood market of Wuhan was identified as the suspected hub of the coronavirus outbreak by the United States Centers for Disease Control and Prevention (CDC).  Now, there have been more new cases reported from countries outside of China than from China. Two new countries/territories/areas from the Western Pacific Region and the Eastern Mediterranean Region have reported cases of COVID-19.

The mysterious novel coronavirus outbreak was identified by Chinese authorities on January 7 and since named COVID-19, is a new strain that had not been previously identified in humans. The coronavirus (COVID-19) outbreak poses a significant life-threatening and economic risk throughout the world. Over 414,179 cases have been diagnosed across 48 countries, resulting in over 18,440 reported deaths. As far as concern, due to this contagious coronavirus outbreak death has been confirmed in Hong Kong, the Philippines, Japan, France, Iran, Taiwan, South Korea, and other countries. On 31st January 2020, officially WHO has declared it a global health emergency, due to increases number of infectious cases has been confirmed in countries such as South Korea, Afghanistan, France, UAE, and many more countries.

The mortality rate is mostly within 2%~3%, well in line with the WHO official estimate. For example, MERS, SARS and the Wuhan coronavirus appear to cause more severe disease in older people Age group 60-69 years old at 3.6%, 50-59 years old at 1.4% & least 40-49 years old at 0.4%, though uncertainty remains around the latest outbreak. Of the cases of Wuhan coronavirus reported so far, none are yet confirmed to be among children.

Treatment Landscape

Several vaccines, antibiotics & anti-retroviral drugs such as FTNX-1800 (Tonix Pharmaceuticals), Leronlimab (CytoDyn), etc. are undergoing the clinical trials for coronavirus outbreak. Apart from this novel therapies, supportive therapy is also recommended including over the counter medicine for a sore throat, fever & pain reliever medications, etc. to relieve the symptoms, if happens. Additionally, drink plenty of fluids, get rest and sleep as much as possible is recommended.

Government Initiatives

The government has taken initiative to allocate the emergency funds for improving public health to curb the current global coronavirus outbreak. For instances, The Trump Administration is looking to allocate approximately $2.5 billion in emergency funds to help prepare the country should the current coronavirus crisis become a public health care threat in the U.S. Other governments and global health authorities are taking similarly aggressive steps to prepare for the virus’s continued spread. Furthermore, the UK government like Health Secretary Matt Hancock has announced that £20m in Government funding will be given to the Coalition for Epidemic Preparedness Innovations (CEPI) to advance programmes targeting the coronavirus.