COVID-19

World Asthma Day 2021

by

World Asthma Day is observed every year on the first Tuesday of May to raise awareness about Asthma and improves the lives of all people with Asthma. Asthma is an inflammatory disorder of the airways causing symptoms such as cough, wheezing, chest tightness and shortness of breath.

This year’s World Asthma Day theme is “Uncovering Asthma Misconceptions”. The theme provides a call to action to address common widely held myths and misconceptions concerning asthma that prevent persons with asthma from enjoying optimal benefit from the major advances in the management of this condition. Common misconceptions surrounding asthma include:

Myth #1

Asthma is a childhood disease; individuals will grow out of it as they age.

Fact: No, asthma can develop at any age in children, adolescents, and the elderly.

Myth #2

Asthma is infectious.

Fact: Asthma is not infectious. However, Acute attack gets precipitated on exposure to various allergens or due to infections (mostly viral).

Myth #3

Asthma sufferers should not exercise.

Fact: When asthma is well controlled, asthma subjects are able to exercise and even perform top sport.

Myth #4

Asthma is only controllable with high dose steroids.

Fact: Asthma is most often controllable with low dose inhaled steroids.

COVID-19 has brought suffering to people everywhere. But patients with asthma are more affected during COVID. In the era of COVID-19 pandemic, here are few measures for Asthma patients:

Steps to protect yourself from COVID-19

  • Get a COVID-19 vaccine shot when it is available.
  • Wear a mask that properly covers your nose and mouth.
  • Maintain social distancing and stay at least 6 feet distance while at public places.
  • Wash your hands with soap and water or use hand sanitizer with 60% alcohol several times in a day
  • Avoid all non-essential travel
  • If anyone in your home is sick, home quarantine the person to reduce the risk of spreading the virus.

Tips to Manage Asthma

  • Stay away from your asthma triggers.
  • Continue having your regular asthma medications including inhalers with steroids
  • Never discontinue any medications or change asthma treatment plant without talking to your physician
  • Stock at home your emergency supply of prescription medications such as inhalers and other drugs. Make sure you also maintain a stock of non-prescription medications and essentials on hand.
  • Be very cautious while using any cleaning agents and disinfectants.

Coronavirus (COVID19): Updates

by

Glenmark Pharmaceuticals had launched FabiFlu, India’s first COVID-19 drug

Glenmark Pharmaceuticals had launched FabiFlu, an antiviral drug Favipiravir, to cure patients with mild to moderate coronavirus at a price tag of about Rs 103 per tablet. FabiFlu would be available in the form of a 200 mg tablet and will be at a maximum retail price (MRP) of Rs 3,500 for a strip of 34 tablets. It is the first oral favipiravir-approved medication for the treatment of COVID-19 in India. FabiFlu is a prescription-based medication with a recommended dose being at 1,800 mg twice daily on day one, followed by 800 mg twice daily up till day 14.

Cipla had launched Cipremi, a COVID-19 Antiviral Drug

Cipla had launched antiviral drug i.e., Cipremi for the treatment of COVID-19. Cipremi is available in the form of lyophilized powder (freeze dry) for injection 100mg. It has been approved for adult and pediatric patients who have been hospitalized. This drug has been granted regulatory approval by the Drug Controller General of India (DCGI) for restricted emergency use in India as part of the accelerated approval process considering the urgent and unmet medical need. The clinical trials have demonstrated the efficacy of Cipremi for the patients on oxygen support after falling ill to coronavirus. 

United States provided $2 Billion to Novavax & Regeneron for Covid-19 Vaccine

The federal government awarded $2 billion to Novavax Inc. & Regeneron Pharmaceuticals for the development and manufacturing of an experimental drug and a potential vaccine against Covid-19. Novavax Inc. has received $1.6 billion from the federal government’ to fund clinical studies of its experimental coronavirus vaccine and establish large-scale manufacturing of doses. Regeneron Pharmaceuticals Inc. has received a $450 million federal contract to manufacture thousands of doses of its experimental Covid-19 treatment that the government would distribute for free to the public if the drug is authorized for use by regulators.

BioSig Technologies Collaborates with Albany Molecular for its Drug Merimepodib, a Coronavirus Treatment

BioSig Technologies had entered into the collaboration with Albany Molecular Research Inc to evaluate the merimepodib for the treatment of SARS-CoV-2, the virus that causes Covid-19. Under the terms of the collaboration, both companies would evaluate the drug as a standalone treatment and in combination with other antiviral agents or immune modulators. This collaboration would help in rapid transfer, scale-up and validation of merimepodib API manufacture as the future supply chain and commercialization strategy.

Hetero Receive the Approval to Produce & Market Remdesivir

Indian pharmaceutical firm Hetero had received approval from the Drug Controller General of India to manufacture and market the experimental antiviral drug remdesivir for the treatment of coronavirus. Hetero’s generic version of Remdesivir would be sold under the brand name Covifor in India. Covifor would be available in 100 mg vials that would be injected into the patient at a hospital facility under the proper supervision of a doctor or trained healthcare worker. The drug would be launched in India under a licensing agreement with Gilead Sciences Inc, an American biopharmaceutical firm, to expand access to Covid-19 medication in poor countries.

Mateon Therapeutics Secured a $2 Million Financing with Golden Mountain Partners (GMP) to Conduct Clinical Trial Evaluating OT-101 against COVID-19

Mateon Therapeutics had secured a $2 million in debt financing with Golden Mountain Partners (GMP) for the conduct of a clinical trial evaluating OT-101 against COVID-19. OT-101 is an antisense against the host TGF-β protein required for viral replication and its overexpression likely to cause the wide range of clinical symptoms associated with COVID-19 including Kawasaki syndrome.

Coronavirus Recent Updates

by

Moderna Vaccine’s Progress, Excites COVID-19 Markets

Moderna Inc’s experimental COVID-19 vaccine, the first to be tested in the United States, produced protective antibodies in a small group of healthy volunteers. However, the data comes from eight people who took part in a 45-subject safety trial that kicked off in March. Afterward, Phase I trial results of the vaccine, mRNA-1273, have been found promising. On May 7, the company has received regulatory clearance for the Phase II trial that would involve a much larger sample size. The imminent Phase II study start is a crucial step forward as we continue to advance the clinical development of mRNA-1273, our vaccine candidate against SARS-CoV-2. With the goal of starting the mRNA-1273 pivotal Phase III study early this summer, Moderna is now preparing to potentially have its first BLA approved as soon as 2021. In addition, Moderna launched a $1.34 billion share offering at an offer price of $76 per share. The company had earlier said it plans to sell $1.25 billion in common stock to raise money for vaccine development and manufacturing.

Canada Approves the First Clinical Trial for potential Covid-19 Vaccine

The race is on to find a vaccine for COVID-19 and Canada’s government may have taken the lead after its national drug regulator cleared a plan to begin studying the front-running candidate. This investigation drug is an adenovirus-based vaccine developed jointly by China’s CanSino Biological and the National Research Council of Canada and is one of eight to have made it to the clinic, and is already in phase II development in China. 

Gilead Signs Licensing Agreement With Cipla, Jubilant Life, Mylan, Hetero Labs & Ferozsons Labs

Gilead signed non-exclusive licensing agreements with five companies based out of India and Pakistan for their investigational drug remdesivir, to treat COVID-19 patients. Gilead signed licenses with Cipla, Jubilant Lifesciences, Hetero Labs, Mylan, and Ferozsons Labs. Under the agreement for remdesivir, Gilead would transfer its technology on how the API and formulations are developed to the companies and distribute it in 127 countries including India.

The deal would ensure accessibility and affordability of remdesivir in especially lower income countries with poor health infrastructure. Besides India, this license agreement extends to countries such as Afghanistan, Bhutan, Cambodia, South Africa and Egypt to name a few. It does not extend to larger and more developed countries such as US, UK, Europe, China, Australia amongst others. Hence, the drug was given emergency use authorization (EUA) by the USFDA for treating COVID-19 patients, but is yet to be formally approved by the drug regulator. Further, this is the second voluntary license agreement that Gilead has signed.

China Tests Coronavirus Drug That Aims to Stop Pandemic Sans Vaccine

A Chinese laboratory has been developing a drug it believes has the power to bring the coronavirus (COVID-19) pandemic to a halt. A drug being tested by scientists at China’s prestigious Peking University could not only shorten the recovery time for those infected but even offer short-term immunity from the virus. It is isolated from the blood of 60 recovered patients. The drug has been successful at the animal testing stage. The injection of the neutralizing antibodies into infected mice resulted in reducing the viral load was reduced by a factor of 2,500 This potential drug has a therapeutic effect.

Oxford’s Jenner Institute & AstraZeneca Collaborate Together

Oxford’s Jenner Institute had entered into the collaboration with the AstraZeneca for the development of the vaccine. The experimental vaccine, known as ChAdOx1 nCoV-19, is one of the front runners in the global race to provide protection against the new coronavirus causing the COVID-19 pandemic.

Microsoft & UnitedHealth Launch COVID-19 Screening App For The Workplace

Microsoft and UnitedHealth Group are launching a free smartphone app that businesses and employees can use to digitally screen for COVID-19 symptoms and clear those who can return to work. Based on guidelines from the Centers for Disease Control and Prevention, the ProtectWell app uses Microsoft’s chatbot interface to ask the user a series of daily questions, such as whether they have had a fever or any respiratory symptoms or whether they’ve been in contact with anyone diagnosed with COVID-19.

Fitbit to Develop Emergency COVID-19 Ventilator

Fitbit aims to wield its fitness-focused supply chain to start building its own COVID-19 ventilator and plans to submit its designs to the FDA in the near future. This device would include more features than the typical emergency alternatives developed in response to the spreading coronavirus pandemic, which are largely made to be built quickly and at scale using off-the-shelf components and mechanically deliver puffs of air at a fixed rate. 

Commercialized Diagnostic Products for Novel Coronavirus (COVID-19) in India

by

The importance of diagnostic market increased significantly amid the coronavirus pandemic outbreak, by providing a new potential growth opportunity pocket which enables the diagnostic companies to launch and commercialized new product in the Indian market to save the lives of thousand people, by ramping up the diagnosis process through identification of the virus and treatment. The major drivers are lifestyle diseases rising, improving per capita, increasing awareness, and increasing payer coverage. Apart from it, they are certain influencing factors such as accessibility, lack of specialists, lack of standardization & affordability still a concern.

Out of many private companies, recently the government had allowed two private companies include Indian company MyLab and German firm Altona Diagnostics – to supply COVID-19 test kits to both government as well as private testing laboratories in India. In addition, two south Korean firms, Seegene and SD Biosensor have received government approval to supply RT-PCR based Novel Coronavirus (COVID-19) diagnostic kits in India.

The government has also approved 12 rapid antibody test kits for COVID-19 diagnosis companies such as BioMednomics (USA), Getein Biotech (China), Sensing Self Ltd (Singapore), Hangzhou Biotest Biotech (China), AmonMed Biotechnology Co (China), Beijing Tigsun Diagnostics Co Ltd (China), Biomaxima (Poland), CTK Biotech (USA), Hunan Lituo Biotechnology Co (China), Vivacheck Lab (China) and Wondfo (China). While, The rapid antibody test facilitate result within 30 minutes, thereby providing additional benefits. The test comes positive after 7 to 10 days of infection. While a positive test indicates exposure to COVID-19, negative does not rule out the infection.

There are several companies issued a CDSCO license in the Indian market such as Altona Diagnostics, MY LABS, Roche & Seegene, etc.

Altona Diagnostics: RealStar SARS-CoV-2 RT-PCR Kits

Altona Diagnostics, RealStar SARS-CoV-2 RT-PCR Kits (1.0 and U.S versions), is a reagent system, based on real-time PCR technology, for the qualitative detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These tests can be run in parallel: RealStar® Influenza Screen & Type RT-PCR Kit 4.0.etc

Mylab Discovery Solutions Pvt Ltd: PathoDetect COVID-19 Qualitative PCR ‘Made in India’ test kits

Pune based Mylab Discovery Solutions Pvt Ltd developed PathoDetect COVID-19 Qualitative PCR ‘Made in India’ test kits are capable of diagnosing a patient in two-and-a-half hours, unlike the imported kits, which currently take up to seven hours. The kits have reportedly been developed in a record time of six weeks and will reduce the cost of testing to a fourth of the current cost. It also the first Indian diagnostic kit approved by the ICMR against COVID-19.

Allplex: 2019-nCoV Assay

Allplex 2019-nCoV Assay is a multiplex Real-time PCR assay for simultaneous detection of 3 target genes of SARS-CoV-2 in a single tube. The assay is designed to detect RdRP and N genes specific for SARS-CoV-2, and E gene for all of Sarbecovirus including SARS-CoV-2. It shows PCR with high sensitivity and specificity by giving results within 1 hour and 50 minutes after extraction. It has also inserted an automatic data analyzer and LIS interlocking with Seegene Viewer. It also gives quick response and proper treatment provided by accurate test results.

Genesig: Real-Time PCR COVID-19

Genesig Real-Time PCR COVID-19 (CE) is CE-IVD marked and intended for in vitro diagnostic use in Europe.  This is a rapid kit detection and exclusive to the COVID-19 strain, however not involved in the detection of other related coronavirus strains. It has high priming efficiency and a highly specific detection profile. Besides, Lyophilised components for ambient shipping. It also involved in driving accurate controls to confirm extraction and assay validity.

Roche Diagnostics: Cobas SARS CoV-2 Diagnostic Test Kit

Roche Diagnostics India has received the license from the country’s drug regulator DCGI for its ‘cobas SARS CoV-2’ diagnostic test kit, making it the first private firm to get permission to conduct coronavirus tests Since, the NIV has tested 14 privately-made kits and recommended three kits made Atona Diagnostics, MyLab, and Seegene for CDSCO license.

Commercialized Diagnostic Products

CompanyDiagnostic KitProduct Description
Altona diagnosticRealStar SARS-CoV- 2 RT-PCR kit 1.0Reagent system, based on real-time PCR technology, for the qualitative detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These tests can be run in parallel  
MY LABPatho DetectPathoDetect COVID-19 Qualitative PCR kit would cost just around one-fourth of the current procurement cost.  
BGIReal Time Fluorescent RT-PCR kit for detecting 2019-nCoVReagents commercially distributed as a kit to labs Can only be run in high complexity labs
Krishgen BiosystemSARS-CoV-2 Coronavirus Real-Time RT-PCR (RT-Qpcr) Detection kit v1Uses Taqman probes. Taqman Probes are widely used RT-PCR assay because of its sensitivity and specificity with dual quenchers for higher accuracy. With 2/3 Primer/Probe option  
ABITaqMan 2019-nCov Control kit v1TaqMan 2019-nCoV Control Kit v1 is a synthetic positive control that contains target sequences for each of the assays included in the TaqMan 2019-nCoV Assay Kit v1 (Cat. No. A47532). The control includes synthetic DNA target sequences for three SARS-CoV-2 genes (ORF1ab, S protein, and N protein) and the human RNase P RPPH1 gene.

HIMEDIAHi-PCR Coronavirus (CoVID-19) Probe PCR kitTo perform PCR on various DNA templates for numerous downstream applications. It also contains all necessary components including HiMedia’s ultra-efficient Taq Polymerase, dNTP mixture, and MgCl2 for reproducible PCR results.   
HUWELQuantiplus Coronavirus (2019nCoV) Detection kitThe kit has a synthetic gene cloned in a plasmid as a positive control. The primers set is cross-verified for specificity with several RNA and DNA viruses and bacteria  
IIT-DELHISYBR Green based one step QRT-PCRFirst probe-free assay for COVID-19 approved by the ICMR and it will be useful for specific and affordable high throughput testing. It can easily be scaled up as it does not require fluorescent probes.  Targeting large-scale deployment of the kit at affordable prices with suitable industrial partners as soon as possible.  
KILPEST (BLACKBIO) TRUPCRReal-Time PCR Test is a molecular detection test that screens and detects Covid-19 specific genes and is confirmatory.  
GenesigCoronavirus (COVID-19) genesig Real Time PC   R AssayRapid detection and exclusive to the COVID-19 strain Does not detect other related coronavirus strains High priming efficiency  
Roche  LightMix Modular SARS and Wuhan CoV E geneE_Sarbeco_F1 (Oligonucleotide ID) Contains ACAGGTACGTTAATAGTTAATAGCGT (5’-3’ sequence ) by using use 400 nM per reaction
Roche  LightMix Modular SARS and Wuhan CoV N geneN_Sarbeco_F1 (Oligonucleotide ID) Contains CACATTGGCACCCGCAATC (5’-3’ sequence ) by using use 600 nM per reaction
Roche  LightMix Modular Wuhan RdRp geneDetect Wuhan 2019 SARS-like CoV pneumonia virus Sensitivity is 3.8 copies per reaction (95% CI: 2.7–7.6) Lot release min 10 copies  
SeegeneAllplex 2019-nCoV assayMultiplex real-time PCR assay for simultaneous detection of 3 target genes of SARS-CoV-2 in a single tube Results within 1 hour and 50 minutes after extraction  

Emerging Diagnostic Test Products For Novel Coronavirus (COVID-19)

by

Over the last few months, the coronavirus outbreak has spread to various countries such as China, South Korea, Italy, Iran, Japan, Singapore, Hong Kong, the United States, and other countries. It has endangered thousands of lives in a short span of time. Hence, several diagnostic companies have been focused on the development of promising diagnostic test products to expedite the diagnosis process as quickly as possible to save the lives of people.

The pipeline landscape of the coronavirus detection is robust with the involvement of several diagnostic test products such as PANDAA qDx SARS-CoV-2, RabWiz Ultra-Sensitive COIV-19 Viral Antigen Test Kit (ELISA) & AiroStotleCV19 (Breath VOCs), etc. Below is a list of the company and its product descriptions and key information for all the emerging diagnostic test products

Canary Health Technologies: AiroStotleCV19 (Breath VOCs)

Canary Health Technologies has developed AiroStotleCV19 (Breath VOCs), a highly sensitive, specific, non-invasive and cost-effective test using VOCs analysis as a result of oxidative stress offers a potentially powerful new approach to early diagnosis COVID-19

Aurora Biomed Inc.: SARS-COV-2 Detection Kit

SARS-COV-2 Detection Kit for the VERSA Viral Detection workstation involved in targeting genes includes ORF1ab and N gene and produces 24 tests per kit. It shows a detection limit in 200copies per mL. However, positive and negative test control is also used to monitor the test accuracy.

GNA Biosolutions GmbH: SARS-CoV-2 Detection Kit

GNA Biosolutions GmbH has developed the SARS-CoV-2 Detection Kit on a portable PCA Analyzer which comprised of an instrument and disposable test chips. The test would run on the neo system whichamplifies and detects genetic material and can be used to test eight samples at a time. Moreover, it can also provide analysis within 15-25 minutes.

FluroTest LLC: CompleTest Platform Technology

FluroTest LLC uses the CompleTest platform technology to test for a range of viruses including COVID-19, as well as accurately determining the viral load.  Additionally, FluroTest ‘s technology can be adapted to allow for the detection of specific anti-SARS-CoV-2 human antibodies in blood samples, potentially confirming the development of immunity. Once developed, both tests would be administered at point-of-collection with results expected to be available in less than 15 minutes.

Attomarker Ltd: Immuno-Kinetic Assay for Covid-19

Attomarker Ltd has Developed the Quantitative Immuno-kinetic assay for Covid-19 IgG+IgM+IgA for a multiantigen panel with CRP (automated) which relies on detecting virus RNA in a swab sample from the patient’s throat or nose. It is a Portable device Attomarker Liscar which comprised of 4 bench-top instruments, each providing results in just ten minutes.

Emerging Diagnostic Products Landscape for Novel Coronavirus (COVID-19)

Company Name/ SponsorsProduct Test TypeProduct Description
Academia Sinica  Anti-SARS-CoV-2 nucleocapsid protein human IgM/IgG rapid detection kitSimple detection procedure Only 15- 20 minutes
Access Bio Korea, Inc. CareStart COVID-19 IgM/IgGThe device is designed to amplify a total of two unique target genes of SARS-CoV-2 to improved sensitivity and with its high sensitivity
AIVD Biotech Inc. COVID-19 IgG/IgM Rapid Test (colloidal gold-based)OEM onlyResults within 10-15 min
Aldatu Biosciences PANDAA qDx SARS-CoV-2 Real-time PCR detection of COVID-19 Disease
Ativa Medical Ativa Enhanced ScreenMiniaturized low-cost diagnostic testsImmediate lab-quality results
Attomarker Ltd Quantitative Immuno-kinetic assay for Covid-19 IgG+IgM+IgA for a multiantigen panel with CRP (automated) It relies on detecting virus RNA in a swab sample from the patient’s throat or nosePortable Attomarker Liscar  bench-top instrument, each providing results in just ten minute
Aura Biotechnologies Ltd 
Quick COVID-19 Colorimetric LAMP PCRFast and simple yet accurate detection for coronavirusTakes 30 minutes’ assay
Aurora Biomed Inc. SARS-COV-2 Detection Kit for the VERSA Viral Detection workstation Target genes: ORF1ab and N gene200 copies per mL detection limitPositive and negative controls to monitor test accuracy24 tests per kit
Beijing Infervision Technology Co. Ltd InferRead CT PneumoniaCT-AI Based model is efficient and reliable
Canary Health Technologies AiroStotleCV19 (Breath VOCs)A highly sensitive, specific, non-invasive and cost-effective test using VOCs analysis as a result of oxidative stress offers a potentially powerful new approach to early diagnosis COVID-19
DNA Software, Inc. Upper Respiratory Virus Panel, multiplex PCR, COVID-19, Influenza A BAutomated consensus design of multiple variants of DNA or RNA targets
FemtoDx COVID-19 Antibody TestAt Home testThe test will take under 5 minutesEasy to use the device
FemtoDx COVID-19 Rapid Home Nucleic Acid Test At Home testThe test will take under 5 minutesEasy to use the device
FluroTest LLC Complete TestCompleTest platform technology to test for a range of viruses including COVID-19, as well as accurately determining the viral load.
Fluxergy LLCFluxergy Sample-to-Answer SARS-CoV-2 RT-PCRA point-of-use device capable of comprehensive laboratory
testing
Genedrive plc Genedrive 96 SARS-CoV-2 Kit The assay combines Genedrive’s PCR chemistry integrated with Cytiva’s LyoStable stabilization technology.
GNA Biosolutions GmbH SARS-CoV-2 Detection Kit on portable PCA AnalyzerThe system amplifies and detects genetic material and can be used to test eight samples at a timeProvide analysis within 15-25 minutes  
AB Diagnostic Systems GmbH abia SARS-CoV-2 AbThe world’s easiest to use a range of diagnostic kits for HIV, hepatitis A, B, C, D, E infections, SARS-CoV-2 (COVID-19), prenatal diagnostics (TORCH), hormones (thyroid, fertility), tumor markers and moreCompletely recyclable
Abwiz BioRabWiz Ultra Sensitive COIV-19 Viral Antigen Test Kit (ELISA)It can play a critical role in the development of next-generation COVID-19 diagnostic toolsHighly-specific SARS-CoV-2 monoclonal antibodies

CE Marked Diagnostic Products for Coronavirus Outbreak

by

The coronavirus pandemic had created a challenge for the diagnostic companies to developed and commercialized new diagnostic products. Hence, several companies have developed various products to meet the demand for assays to detect SARS-CoV-2 coronavirus. These diagnostic test products are used only for diagnostic and clinical use.

Companies such as Altona Diagnostics, DiaCarta, DiaSorin Molecular, Quidel Corporation, PerkinElmer, etc. have received CE Mark in the European Countries.

Companies and Their Serological and PCR Oriented Diagnostic Products

PerkinElmer, Inc.: Perkinelmer New Coronavirus Nucleic Acid Detection Kit

PerkinElmer New Coronavirus Nucleic Acid Detection kit is a real-time RT-PCR test intended for the qualitative detection of nucleic acid from SARS-CoV-2 in human oropharyngeal and nasopharyngeal swab samples. It is highly reliable to perform verified with case-studies from the outbreak’s point of origin and highly sensitive for Limit of detection of 20 copies/mL. In- addition, an automated option is also available to meet a broad range of sample throughput.

Altona Diagnostics: RealStar SARS-CoV-2 RT-PCR Kits

RealStar SARS-CoV-2 RT-PCR Kits (1.0 and U.S versions), is a reagent system, based on real-time PCR technology, for the qualitative detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These tests can be run in parallel: RealStar Influenza Screen & Type RT-PCR Kit 4.0.etc.

DiaSorin Molecular LLC: Simplexa COVID-19 Direct

Simplexa COVID-19 Direct reagents are commercially distributed as a kit to labs and can run 1 specimen at a time. It can also be run in moderate and high complexity labs

Quidel Corporation: Lyra SARS-CoV-2 Assay

Lyra SARS-CoV-2 Assay is a real-time RT-PCR test intended for the qualitative detection of nucleic acid from SARS-CoV-2 in a nasopharyngeal or oropharyngeal swab. It is ready to use assay.

DiaCarta, Inc: Quantivirus SARS-Cov-2 Test Kit

QuantiVirus SARS-CoV-2 Test kit is based on Real-Time PCR technology, developed for specific detection of SARS-CoV-2 (COVID-19) viral RNA extracted from nasopharyngeal swabs, oropharyngeal swabs, and sputum. It can also detect three genes, Orf1ab, N and E genes, and different SARS-CoV-2 virus strains. Moreover, its Sensitivity is 100 copies per mL and within less than 2 hours it gives results by using qPCR machines

CE Marked Diagnostic Products for Coronavirus Outbreak in Europe

Company/
Organization 		Test Name Europe Regulatory Status Technology
3D Medicines SARS-CoV-2 and Influenza A & B RT-qPCR Detection Kit CE mark 3/2020 PCR
Altona Diagnostics RealStar SARS-CoV-2 RT-PCR Kits (1.0 and U.S versions) CE mark 4/2020 PCR
Anatolia Geneworks Bosphore Novel Coronavirus (2019-nCoV) Detection Kit CE mark 2/2020 PCR
AusDiagnostics AusDiagnostics SARS-CoV-2, influenza, RSV panel   CE mark 3/2020   PCR
BAG Diagnostics Viro-Q SARS-CoV-2 kit CE mark 4/2020 PCR
Beroni Group SARS-CoV-2 IgG/IgM Antibody Detection Kit CE mark 4/2020   Serological
BGI Real-Time Fluorescent RT-PCR kit for detecting SARS-2019-nCoV CE mark 3/2/2020 PCR
BioMérieux SARS-COV-2 R-GENE test CE mark 4/2020 PCR
Bioneer AccuPower COVID-19 Real-Time RT-PCR Kit, AccuPower SARS-CoV-2 Real-Time RT-PCR Kit CE mark PCR
CerTest BioTec ViaSure SARS-CoV-2 Real Time PCR Detection Kit CE mark 3/2020 PCR
Co-Diagnostics Logix Smart Coronavirus Disease 2019 (COVID-19) Kit CE mark 2/2020 PCR
Credo Diagnostics Biomedical VitaPCR SARS-CoV2 Assay CE mark 3/2020   PCR
DiaCarta QuantiVirus SARS-CoV-2 test kit CE mark 3/2020     PCR
DiaSorin Liaison SARS-CoV-2 S1/S2 IgG CE mark 4/2020 Serological
DiaSorin Molecular Simplexa COVID-19 Direct CE mark 4/2020 PCR
Erba Mannheim ErbaLisa COVID-19 ELISA kits CE mark 4/2020 Serological
Euroimmun/PerkinElmer EuroRealTime SARS-CoV-2 CE mark 3/2020 PCR
Euroimmun/PerkinElmer Anti-SARS-CoV-2 ELISAs (IgA and IgG CE mark 3/2020 Serological
Genetic Signatures EasyScreen SARS-CoV-2 detection kit CE mark 3/2020 PCR
Genetron Detection Kit for Novel Coronavirus (SARS-CoV-2) RNA (PCR-Fluorescence Probing) CE mark 4/2020 PCR
Genomica/
PharmMar Group 		2 kits: qCOVID-19, CLART COVID-19 CE mark 3/2020 PCR
Gold Standard Diagnostics/
Eurofins Technologies 		NovaLisa SARS-CoV-2 (US: GSD SARS-CoV-2) IgG, IgM, IgA assays CE mark 4/2020 Serological
JN Medsys ProTect Covid-19 kit CE mark 4/2020 PCR
Kogene Biotech 2019 Novel Coronavirus Real-time PCR Kit CE mark PCR
NeuMoDx Molecular NeuMoDx SARS-CoV-2 Assay CE mark 5/2020 PCR
Novacyt/
Primerdesign 		COVID-19 Genesig Real-Time PCR assay CE mark 2/2020 PCR
Osang Healthcare GeneFinder COVID-19 Plus RealAmp Kit CE mark 2/2020 PCR
PathoFinder RealAccurate Quadruplex Corona-plus PCR Kit CE mark 4/2020 PCR
PerkinElmer PerkinElmer New Coronavirus Nucleic Acid Detection Kit CE mark 3/2020 PCR
PlexBio IntelliPlex SARS-CoV-2 Detection Kit CE mark 5/2020 PCR
Qiagen QiaStat-Dx Respiratory SARS-CoV-2 Panel CE mark 3/2020 PCR
Quidel Lyra SARS-CoV-2 Assay CE mark 3/2020 PCR
Quotient Limited MosaiQ COVID-19 Antibody Microarray CE mark 5/2020 Serological
Roche Cobas SARS-CoV-2 Test CE mark 2020 PCR
Seegene Allplex 2019-nCoV Assay CE mark 2/2020 PCR
Sentinel Diagnostics STAT-NAT COVID-19 HK kit, B kit CE mark 3/2020 PCR
Shanghai Fosun Long March Medical Science/Shanghai Fosun Pharmaceutical novel coronavirus nucleic acid detection kit CE mark 3/2020 PCR
Siemens Healthineers Fast Track Diagnostics (FTD) SARS-CoV-2 Assay CE mark 4/2020 PCR
Snibe Diagnostics Maglumi 2019-nCoV (SARS-CoV-2) IgM/IgG kits CE mark 2/2020 Serological
SolGent DiaPlexQ Novel Coronavirus (2019-nCoV) Detection kit CE mark 2/2020 PCR
SureScreen Diagnostics SureScreen COVID19 IgM/IgG Rapid Test Cassette CE mark 2020 Serological
Systaaq Diagnostic Products 2019-Novel Coronavirus (COVID-19) Real Time PCR Kit CE mark 3/2020 PCR
Tataa Biocenter TATAA GrandPerformance SARS-CoV-2 detection kit CE mark 3/2020 PCR
Thermo Fisher Scientific TaqPath COVID-19 Combo Kit, RT-PCR CE-IVD Kit CE mark 3/2020 (CE-IVD kit) PCR
TIB Molbiol Syntheselabor Sarbecovirus
E-gene 		CE mark 2/2020 PCR
Vela Diagnostics ViroKey SARS-CoV-2 RT-PCR Test CE mark 4/2020 PCR  
Vision Medicals SARS-CoV-2 Clinical Sequencing assay CE mark 3/2020 PCR
YD Diagnostics MolecuTech Real-Time COVID-19 CE mark 3/2020 PCR

FDA Approved Emergency Use Authorizations (EUAs): Diagnostic Products for Novel Coronavirus Detection

by

Globally, the coronavirus (COVID-19) pandemic outbreak has shown a drastic impact on the diagnostic companies resulting in a shortage of reagent, new product launch, and developing a pipeline. To combat the situation, FDA has been working continuously to facilitate the development and availability of medical and diagnostic products, for use by patients, physicians, and healthcare to expedite the diagnosis process as quickly as possible.

Hence, Food and Drug Administration (FDA) provides the Emergency Use Authorizations (EUAs), to diagnostic companies to help make medical and diagnostic products available as quickly as possible to treat or diagnosis the chronic or life-threatening disease during public health emergencies.

Several companies such as Abbott Laboratories, Hologic, Quidel Corp, and Roche Diagnostics have received emergency use authorization from the Food and Drug Administration (FDA) for their COVID-19 diagnostic assays for ramping up production to help alleviate testing shortages. The molecular diagnostic tests are generally authorized for the qualitative detection of nucleic acid from SARS-CoV-2 in specific upper and lower respiratory specimens from individuals suspected of COVID-19 by their healthcare provider. The specific specimen types for each test can be found in the authorization letter.

Some molecular diagnostic tests may require a highly experienced expertise to manually perform the test (e.g., perform an RNA extraction step usually using specific extraction platforms and kits), while other tests are automated and require only limited training to perform). Typically, manually performed tests are authorized for use by laboratories certified to perform high-complexity tests, while automated tests are authorized for use by laboratories certified to perform moderate complexity tests and/or at the point-of-care by facilities operating under a CLIA Certificate of Waiver.

Major Companies & their Molecular Diagnostic Products

Abbott Laboratories: Abbott RealTime SARS-CoV-2 Assay

Abbott RealTime SARS-CoV-2 Assay is a real-time (RT) polymerase chain reaction (PCR) technology for the qualitative detection of nucleic acids from the SARS-CoV-2 virus and diagnosis of SARS-CoV-2 virus infection from individuals. It is a fully automated solution to help laboratories to address the urgent need for automated, high-volume patient testing during the Coronavirus (COVID-19) pandemic.

Luminex Molecular Diagnostics, Inc: NxTAG CoV Extended Panel

The NxTAG CoV Extended Panel detects SARS-CoV-2 detection using three viral genes (ORF1ab, E gene, and N gene). It provides sensitive and reliable results. It also provides a highly scalable and cost-effective solution.           

Altona Diagnostics: RealStar SARS-CoV-2 RT-PCR Kits (1.0 and U.S versions)

RealStar SARS-CoV-2 RT-PCR Kits (1.0 and U.S versions), is a reagent system, based on real-time PCR technology, for the qualitative detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These tests can be run in parallel with RealStarInfluenza Screen & Type RT-PCR Kit 4.0.etc

InBios International, Inc: Smart Detect SARS-CoV-2 rRTPCR Kit

Smart Detect SARS-CoV-2 rRTPCR Kit is a real-time RT-PCR test for the qualitative detection of nucleic acid from severe acute respiratory syndrome-related coronavirus 2 in human nasopharyngeal, anterior nasal, and mid-turbinate nasal swab specimens from individuals suspected of COVID-19

FDA Emergency Use Authorizations: Diagnostic Products Landscape

SPONSOR PRODUCT DESCRIPTION
Center for Disease Control and Prevention (CDC)CDC 2019-nCoV Real-Time RT-PCR Diagnostic Panel Developed by CDC and initially distributed to public health labs across the country
Can only be run in high complexity labs
Wadsworth – New York State Public Health New York SARS-CoV-2 Real-time Reverse Transcriptase (RT)-PCR Diagnostic Panel   Developed by Wadsworth based on CDC’s published protocol Run in qualified labs across New York State Can only be run in high complexity labs
Roche Molecular Systems, Inc. cobas SARS-CoV-2 for use on the cobas 6800/8800 Systems Commercially distributed as a kit to labs
Can be run in moderate and high complexity labs
Life Technologies (a part of Thermo Fisher Scientific, Inc.) TaqPath COVID-19 Combo Kit, 100 Rxn, TaqPath COVID19 Combo Kit, 1,000 Rxn Commercially distributed as a kit to labs
Can only be run in high complexity labs
Laboratory Corporation of America COVID-19 RT-PCR Test COVID-19 RT-PCR Amendment Developed and run in high complexity LabCorp labs only; not for broader lab distribution
Amendment permits use of the Pixel by LabCorp COVID-19 test home collection kit allowing patients to self-collect nasal swab specimens at home
The kit provides specimen collection materials and materials to safely mail specimens to an authorized laboratory
Hologic, Inc. Panther Fusion SARS-CoV-2 Assay Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Quest Diagnostics Infectious Disease, Inc. SARS-CoV-2 RNA, Qualitative Real-Time RT-PCR Developed and run in Quest labs only; not a kit for distribution
Can only be run in high complexity labs
Quidel Corporation Lyra SARS-CoV-2 Assay Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Abbott Molecular, Inc. Abbott RealTime SARS-CoV-2 assay Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
GenMark Diagnostics, Inc. ePlex SARS-CoV-2 Test Reagents commercially distributed as a kit to labs
Can run up to 24 specimens at the same time
Can be run in a moderate or high complexity lab
DiaSorin Molecular LLC Simplexa COVID-19 Direct Reagents commercially distributed as a kit to labs
Can run 1 specimen at a time
Can be run in moderate and high complexity labs
Primerdesign Ltd. Primerdesign Ltd COVID-19 genesig Real-Time PCR Reagents commercially distributed as a kit to labs  
Can only be run in high complexity labs
Cepheid Xpert Xpress SARS-CoV-2 test Reagents commercially distributed as a kit to labs
Can run up to 2,000 samples per day Can be run in a high or moderate complexity lab or at the Point of Care (POC) near the patient (deemed CLIA waived)
Mesa Biotech Inc Accula SARS-CoV-2 Test Reagents commercially distributed as a kit to labs
Runs one specimen at a time
Can be run in a high or moderate complexity lab or at the Point of Care (POC) near the patient (deemed CLIA waived)
BioFire Defense, LLC BioFire COVID-19 Test Reagents commercially distributed as a kit to labs
Can run up to 264 tests per day  
Can be run in moderate or high complexity labs
PerkinElmer, Inc. PerkinElmer New Coronavirus Nucleic Acid Detection kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Avellino Labs USA AvellinoCoV2 test Developed and run in Avellino labs; not distributed to other labs
High complexity test limited to authorized laboratories
BGI Genomics Co. Ltd. Real-Time Fluorescent RT-PCR Kit for Detecting SARS-2019- nCoV Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Luminex Molecular Diagnostics, Inc. NxTAG CoV Extended Panel Assay Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Abbott Diagnostics Scarborough, Inc. ID NOW COVID-19 Reagents commercially distributed as a kit Requires a specific platform (ID NOW), of which there are 18,000 installed across the US
Runs one specimen at a time
NeuMoDx Molecular, Inc NeuMoDx SARS-CoV-2 Assay Reagents commercially distributed as a kit
Can run 288 or 96 samples at once, depending on the instrument, and takes 80 minutes per sample
Can be run in high and moderate complexity labs
QIAGEN GmbH QIAstat-Dx Respiratory SARSCoV-2 Panel Detects multiple other respiratory viral and bacterial organisms
Reagents commercially distributed as a kit to labs
Runs one specimen at a time and takes one hour
Can be run in high and moderate complexity labs
EUA for COVID-19 LDTs Laboratory developed tests that are authorized are listed below and hyper link to letter granting inclusion under EUA Authorizes the use of LDTs that meet certain criteria
Authorized tests can be used in the high complexity CLIA-certified lab that developed the test
Ipsum Diagnostics COV-19 IDx Assay Uses commercially available reagents
Can only be run in high complexity labs by Ipsum
Becton, Dickinson & Company (BD) BioGX SARS-CoV-2 Reagents for BD MAX System Reagents commercially distributed as a kit to labs
Fully automated, 8 samples per hour Can be run in moderate and high complexity labs
Luminex Corporation ARIES SARS-CoV-2 Assay Reagents commercially distributed as a kit to labs
Can be run in moderate and high complexity labs
ScienCell Research Laboratories ScienCell SARS-CoV-2 Coronavirus Real-time RT-PCR (RT-qPCR) Detection Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
CoDiagnostics, Inc. Logix Smart Coronavirus Disease 2019 (COVID-19) kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Gnomegen LLC Gnomegen COVID-19 RT-Digital PCR Detection Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
InBios International, Inc Smart Detect SARS-CoV-2 rRTPCR Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
DiaCarta, Inc. QuantiVirus SARS-COV-2 Test Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Becton, Dickinson & Company (BD) BD SARS-CoV Reagents for BD MAX System Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Atila BioSystems, Inc. iAMP COVID-19 Detection Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Maccura Biotechnology (USA) LLC SARS-CoV-2 Fluorescent PCR Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
GenoSensor, LLC. GS COVID-19 RT-PCR KIT Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
KorvaLabs Inc. Curative-Korva SARS-Cov-2 Assay Laboratory Developed Test
High complexity test limited to KorvaLabs, Inc., a certified high complexity laboratory
Fosum Pharma USA Inc Fosun COVID-19 RT-PCR Detection Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
OSANG Healthcare GeneFinder COVID-19 Plus RealAmp Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Trax Management Services Inc. PhoenixDx 2019-CoV Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Seegene, Inc. Allplex 2019-nCoV Assay Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Altona Diagnostics GmbH RealStar SARS-CoV02 RT-PCR Kits U.S. Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
SD Biosensor, Inc. STANDARD M nCoV RealTime Detection Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
SEASUN BIOMATERIALS U-TOP COVID-19 Detection Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Rheonix, Inc. Rheonix COVID-19 MDxAssay Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
LabGenomics Co., Ltd. LabGunCOVID-19 RT-PCR Kit Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
Bio-Rad Laboratories, Inc. Bio-Rad SARS-CoV-2 ddPCR Test Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs
BioFire Diagnostics, LLC BioFire Respiratory Panel 2.1 (RP2.1) Reagents commercially distributed as a kit to labs
Can only be run in high complexity labs

Novel Coronavirus (COVID-19): Key Epidemiology Insights

by

Novel Coronavirus (COVID-19) is the leading cause of mortality and morbidity worldwide. It has spread to more than 200 countries.

According to the World Health Organization (WHO) situation report (29 April 2020), the recent Epidemiology Insights are as follows:

  • The total number of confirmed cases are more than 3million worldwide
  • More than 0.2 million died due to the COVID-19

Major Countries Wise Epidemiology Insights (till date):

  • The United States accounts for the highest number  of confirmed cases with 9,83,457 cases followed by Spain with 2,10,773 cases, Italy with 2,01,505  cases, and the UK with 1,61,149 cases
  • The highest number of new confirmed cases were observed in the United States with 22,541 cases, followed by the UK with  3,996 cases, and Italy with 2,091 cases
  • No new confirmed were observed in France
  • The highest number of death cases were observed in the United States with 50,492 deaths, followed by Italy with 27,359 deaths, Spain with 23,822 deaths and France with 23,627 deaths
  • The highest number of new death cases were observed in the United States with 1,322 cases, followed by Spain with 632 cases, the UK with 586 cases, and Italy with 382 cases
  • No new death cases were observed in China

World Hemophilia Day

by

Every year, the World Hemophilia Day is celebrated on 17 April to raise awareness regarding the hemophilia and other bleeding disorders.

World Hemophilia Day is an international awareness day for hemophilia and other bleeding disorders. Hemophilia is a serious bleeding disorder in which the blood does not clot normally which results in excessive bleeding. People with severe hemophilia may bleed for no reason.

World Hemophilia Day marks the birth anniversary of Frank Schnabel, the founder of the World Federation of Hemophilia. It is an important day for the World Federation of Hemophila (WFH) and the bleeding disorders community.

This year the World Hemophilia Day is celebrated in a way that is sensitive to the risks of the current global novel coronavirus (COVID-19) pandemic. This year all the activities of this day will be observed virtually to the coronavirus spread.

Novel Coronavirus: Recent Updates

by

Novel Coronavirus: Recent Updates

Sanofi and GSK Collaborate to Develop Vaccine for COVID-19

Sanofi and GlaxoSmithKline have signed a letter of intent to develop an adjuvanted vaccine for COVID-19, using innovative technology. Sanofi would contribute its S-protein COVID-19 antigen, which is based on recombinant DNA technology whereas the GSK would contribute its pandemic adjuvant technology. The use of an adjuvant technology would help in reducing the amount of vaccine protein required per dose, allowing more vaccine doses to be produced and therefore help in protecting the more people.

China Approves Two Experimental Coronavirus Vaccines to enter Clinical Trials

China has approved early-stage human tests for two experimental vaccines to combat the new coronavirus. One vaccine is being developed by a Beijing-based unit of Nasdaq-listed Sinovac Biotech, and another vaccine is being developed by the Wuhan Institute of Biological Products.

AstraZeneca to Test the Impact of Cancer Drug Calquence on Coronavirus Patients

AstraZeneca is planning to start a clinical trial of its cancer drug i.e. Calquence to assess its potential to control the exaggerated immune system response associated with COVID-19 infection in severely ill patients.

Calquence (acalabrutinib) belongs to a class of drugs called Bruton’s tyrosine kinase (BTK) inhibitors which can suppress autoimmune diseases. Calquence is currently used to treat certain types of blood cancers, has already been approved for the treatment of adult patients with chronic lymphocytic leukaemia in the United States and several other countries.

Celltrion Identifies Antibody Candidates against COVID-19

Celltrion has successfully selected the most potent antibody candidates to neutralise SARS-CoV-2, the virus causing COVID-19. Celltrion will begin cell-line development mass production of the selected therapeutic monoclonal antibody. The Company would conduct the efficacy and toxicity testing with Korea Centers for Disease Control and Prevention (KCDC) of the selected therapeutic monoclonal antibody in mice and non-human primates.

Immunomic collaborates with PharmaJet and EpiVax for COVID-19 Vaccine

Immunomic Therapeutics has entered into a collaboration with PharmaJet and EpiVax to develop a nucleic acid vaccine candidate against COVID-19. This collaboration would help in developing a vaccine that is scalable, heat-stable and easy to administer using PharmaJet’s Tropis needle-free injection system.

Vir selects Samsung Biologics to Produce COVID-19 Antibodies

Vir Biotechnology has selected South Korea-based Samsung Biologics for large-scale production of antibodies to potentially treat Covid-19. Under the terms of the collaboration, Samsung Biologics would provide the manufacturing services for Vir’s monoclonal antibody (mAb) programme targeting the novel coronavirus, SARS-CoV-2. Vir’s lead mAb candidates, VIR-7831 and VIR-7832, had showed high affinity for the spike protein of SARS-CoV-2 and ability

Eli Lilly to Begin Testing RA Drug Olumiant and an Anti-Ang2 Drug in COVID-19 Patients

Eli Lilly plans to explore the use of its rheumatoid arthritis drug i.e.,  Olumiant (oral JAK1/JAK2 inhibitor)  as a treatment for hospitalized patients with COVID-19. Olumiant (Baricitinib) is approved in more than 65 countries as a treatment for adults with moderately to severely active rheumatoid arthritis. The clinical trial of  Olumiant for COVID-19 would begin this month and results are expected within the next two months.

Moreover, the company is planning to advance LY3127804, an investigational selective monoclonal antibody against Angiopoietin 2 (Ang2), to Phase II testing in pneumonia patients hospitalized with COVID-19 who are at a higher risk of progressing to Acute Respiratory Distress Syndrome (ARDS). Ang2 is known to be elevated in ARDS patients and Lilly will test whether inhibiting the effects of Ang2 with a monoclonal antibody can reduce the progression to ARDS or the need for mechanical ventilation in COVID-19 patients

Promising Clinical Trial Results of Gilead Sciences’ Antiviral Drug Remdesivir for COVID-19

Gilead Sciences Inc.’s experimental drug i.e. remdesivir has shown the promise results in early analysis. All the patients received remdesivir for up to 10 days on a compassionate use basis. The clinical trial demonstrated the clinical improvement was observed in 36 of 53 patients (68%) over the 18 days with 17 of the 30 patients on mechanical ventilation being able to get off the breathing device. Almost half of the patients studied were ultimately discharged, while 13% died. Mortality was highest among those who were on a ventilator, with 18% of them dying. Measurement of efficacy will require ongoing randomized, placebo-controlled trials of remdesivir therapy

FDA Approves Rutgers’ Saliva Test for COVID-19

The diagnostic saliva test developed by RUCDR Infinite Biologics with Spectrum Solutions and Accurate Diagnostic Labs (ADL) has received the Emergency Use Authorization (EUA) from the U.S. Food and Drug Administration (FDA). This test involves the use of the saliva for the diagnosis of the COVID-19.

This test has eliminated the need for collecting the sample through nasopharyngeal or oropharyngeal as the current COVID 19 diagnostic test requires a swab from deep in the nasal passages or the back of the throat. It puts the healthcare workers at risk of catching an infection. The diagnostic saliva test uses easy-to-collect saliva samples instead of the more difficult deep nose swabs in comparison to the existing diagnostic tests and would reduce the risk of healthcare workers from getting the infection.