CoronavirusLockdown

Commercialized Diagnostic Products for Novel Coronavirus (COVID-19) in India

by

The importance of diagnostic market increased significantly amid the coronavirus pandemic outbreak, by providing a new potential growth opportunity pocket which enables the diagnostic companies to launch and commercialized new product in the Indian market to save the lives of thousand people, by ramping up the diagnosis process through identification of the virus and treatment. The major drivers are lifestyle diseases rising, improving per capita, increasing awareness, and increasing payer coverage. Apart from it, they are certain influencing factors such as accessibility, lack of specialists, lack of standardization & affordability still a concern.

Out of many private companies, recently the government had allowed two private companies include Indian company MyLab and German firm Altona Diagnostics – to supply COVID-19 test kits to both government as well as private testing laboratories in India. In addition, two south Korean firms, Seegene and SD Biosensor have received government approval to supply RT-PCR based Novel Coronavirus (COVID-19) diagnostic kits in India.

The government has also approved 12 rapid antibody test kits for COVID-19 diagnosis companies such as BioMednomics (USA), Getein Biotech (China), Sensing Self Ltd (Singapore), Hangzhou Biotest Biotech (China), AmonMed Biotechnology Co (China), Beijing Tigsun Diagnostics Co Ltd (China), Biomaxima (Poland), CTK Biotech (USA), Hunan Lituo Biotechnology Co (China), Vivacheck Lab (China) and Wondfo (China). While, The rapid antibody test facilitate result within 30 minutes, thereby providing additional benefits. The test comes positive after 7 to 10 days of infection. While a positive test indicates exposure to COVID-19, negative does not rule out the infection.

There are several companies issued a CDSCO license in the Indian market such as Altona Diagnostics, MY LABS, Roche & Seegene, etc.

Altona Diagnostics: RealStar SARS-CoV-2 RT-PCR Kits

Altona Diagnostics, RealStar SARS-CoV-2 RT-PCR Kits (1.0 and U.S versions), is a reagent system, based on real-time PCR technology, for the qualitative detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These tests can be run in parallel: RealStar® Influenza Screen & Type RT-PCR Kit 4.0.etc

Mylab Discovery Solutions Pvt Ltd: PathoDetect COVID-19 Qualitative PCR ‘Made in India’ test kits

Pune based Mylab Discovery Solutions Pvt Ltd developed PathoDetect COVID-19 Qualitative PCR ‘Made in India’ test kits are capable of diagnosing a patient in two-and-a-half hours, unlike the imported kits, which currently take up to seven hours. The kits have reportedly been developed in a record time of six weeks and will reduce the cost of testing to a fourth of the current cost. It also the first Indian diagnostic kit approved by the ICMR against COVID-19.

Allplex: 2019-nCoV Assay

Allplex 2019-nCoV Assay is a multiplex Real-time PCR assay for simultaneous detection of 3 target genes of SARS-CoV-2 in a single tube. The assay is designed to detect RdRP and N genes specific for SARS-CoV-2, and E gene for all of Sarbecovirus including SARS-CoV-2. It shows PCR with high sensitivity and specificity by giving results within 1 hour and 50 minutes after extraction. It has also inserted an automatic data analyzer and LIS interlocking with Seegene Viewer. It also gives quick response and proper treatment provided by accurate test results.

Genesig: Real-Time PCR COVID-19

Genesig Real-Time PCR COVID-19 (CE) is CE-IVD marked and intended for in vitro diagnostic use in Europe.  This is a rapid kit detection and exclusive to the COVID-19 strain, however not involved in the detection of other related coronavirus strains. It has high priming efficiency and a highly specific detection profile. Besides, Lyophilised components for ambient shipping. It also involved in driving accurate controls to confirm extraction and assay validity.

Roche Diagnostics: Cobas SARS CoV-2 Diagnostic Test Kit

Roche Diagnostics India has received the license from the country’s drug regulator DCGI for its ‘cobas SARS CoV-2’ diagnostic test kit, making it the first private firm to get permission to conduct coronavirus tests Since, the NIV has tested 14 privately-made kits and recommended three kits made Atona Diagnostics, MyLab, and Seegene for CDSCO license.

Commercialized Diagnostic Products

CompanyDiagnostic KitProduct Description
Altona diagnosticRealStar SARS-CoV- 2 RT-PCR kit 1.0Reagent system, based on real-time PCR technology, for the qualitative detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These tests can be run in parallel  
MY LABPatho DetectPathoDetect COVID-19 Qualitative PCR kit would cost just around one-fourth of the current procurement cost.  
BGIReal Time Fluorescent RT-PCR kit for detecting 2019-nCoVReagents commercially distributed as a kit to labs Can only be run in high complexity labs
Krishgen BiosystemSARS-CoV-2 Coronavirus Real-Time RT-PCR (RT-Qpcr) Detection kit v1Uses Taqman probes. Taqman Probes are widely used RT-PCR assay because of its sensitivity and specificity with dual quenchers for higher accuracy. With 2/3 Primer/Probe option  
ABITaqMan 2019-nCov Control kit v1TaqMan 2019-nCoV Control Kit v1 is a synthetic positive control that contains target sequences for each of the assays included in the TaqMan 2019-nCoV Assay Kit v1 (Cat. No. A47532). The control includes synthetic DNA target sequences for three SARS-CoV-2 genes (ORF1ab, S protein, and N protein) and the human RNase P RPPH1 gene.

HIMEDIAHi-PCR Coronavirus (CoVID-19) Probe PCR kitTo perform PCR on various DNA templates for numerous downstream applications. It also contains all necessary components including HiMedia’s ultra-efficient Taq Polymerase, dNTP mixture, and MgCl2 for reproducible PCR results.   
HUWELQuantiplus Coronavirus (2019nCoV) Detection kitThe kit has a synthetic gene cloned in a plasmid as a positive control. The primers set is cross-verified for specificity with several RNA and DNA viruses and bacteria  
IIT-DELHISYBR Green based one step QRT-PCRFirst probe-free assay for COVID-19 approved by the ICMR and it will be useful for specific and affordable high throughput testing. It can easily be scaled up as it does not require fluorescent probes.  Targeting large-scale deployment of the kit at affordable prices with suitable industrial partners as soon as possible.  
KILPEST (BLACKBIO) TRUPCRReal-Time PCR Test is a molecular detection test that screens and detects Covid-19 specific genes and is confirmatory.  
GenesigCoronavirus (COVID-19) genesig Real Time PC   R AssayRapid detection and exclusive to the COVID-19 strain Does not detect other related coronavirus strains High priming efficiency  
Roche  LightMix Modular SARS and Wuhan CoV E geneE_Sarbeco_F1 (Oligonucleotide ID) Contains ACAGGTACGTTAATAGTTAATAGCGT (5’-3’ sequence ) by using use 400 nM per reaction
Roche  LightMix Modular SARS and Wuhan CoV N geneN_Sarbeco_F1 (Oligonucleotide ID) Contains CACATTGGCACCCGCAATC (5’-3’ sequence ) by using use 600 nM per reaction
Roche  LightMix Modular Wuhan RdRp geneDetect Wuhan 2019 SARS-like CoV pneumonia virus Sensitivity is 3.8 copies per reaction (95% CI: 2.7–7.6) Lot release min 10 copies  
SeegeneAllplex 2019-nCoV assayMultiplex real-time PCR assay for simultaneous detection of 3 target genes of SARS-CoV-2 in a single tube Results within 1 hour and 50 minutes after extraction  

Novel Coronavirus (COVID-19): Key Epidemiology Insights

by

Novel Coronavirus (COVID-19) is the leading cause of mortality and morbidity worldwide. It has spread to more than 200 countries.

According to the World Health Organization (WHO) situation report (29 April 2020), the recent Epidemiology Insights are as follows:

  • The total number of confirmed cases are more than 3million worldwide
  • More than 0.2 million died due to the COVID-19

Major Countries Wise Epidemiology Insights (till date):

  • The United States accounts for the highest number  of confirmed cases with 9,83,457 cases followed by Spain with 2,10,773 cases, Italy with 2,01,505  cases, and the UK with 1,61,149 cases
  • The highest number of new confirmed cases were observed in the United States with 22,541 cases, followed by the UK with  3,996 cases, and Italy with 2,091 cases
  • No new confirmed were observed in France
  • The highest number of death cases were observed in the United States with 50,492 deaths, followed by Italy with 27,359 deaths, Spain with 23,822 deaths and France with 23,627 deaths
  • The highest number of new death cases were observed in the United States with 1,322 cases, followed by Spain with 632 cases, the UK with 586 cases, and Italy with 382 cases
  • No new death cases were observed in China

Novel Coronavirus: Recent Updates

by

Novel Coronavirus: Recent Updates

Sanofi and GSK Collaborate to Develop Vaccine for COVID-19

Sanofi and GlaxoSmithKline have signed a letter of intent to develop an adjuvanted vaccine for COVID-19, using innovative technology. Sanofi would contribute its S-protein COVID-19 antigen, which is based on recombinant DNA technology whereas the GSK would contribute its pandemic adjuvant technology. The use of an adjuvant technology would help in reducing the amount of vaccine protein required per dose, allowing more vaccine doses to be produced and therefore help in protecting the more people.

China Approves Two Experimental Coronavirus Vaccines to enter Clinical Trials

China has approved early-stage human tests for two experimental vaccines to combat the new coronavirus. One vaccine is being developed by a Beijing-based unit of Nasdaq-listed Sinovac Biotech, and another vaccine is being developed by the Wuhan Institute of Biological Products.

AstraZeneca to Test the Impact of Cancer Drug Calquence on Coronavirus Patients

AstraZeneca is planning to start a clinical trial of its cancer drug i.e. Calquence to assess its potential to control the exaggerated immune system response associated with COVID-19 infection in severely ill patients.

Calquence (acalabrutinib) belongs to a class of drugs called Bruton’s tyrosine kinase (BTK) inhibitors which can suppress autoimmune diseases. Calquence is currently used to treat certain types of blood cancers, has already been approved for the treatment of adult patients with chronic lymphocytic leukaemia in the United States and several other countries.

Celltrion Identifies Antibody Candidates against COVID-19

Celltrion has successfully selected the most potent antibody candidates to neutralise SARS-CoV-2, the virus causing COVID-19. Celltrion will begin cell-line development mass production of the selected therapeutic monoclonal antibody. The Company would conduct the efficacy and toxicity testing with Korea Centers for Disease Control and Prevention (KCDC) of the selected therapeutic monoclonal antibody in mice and non-human primates.

Immunomic collaborates with PharmaJet and EpiVax for COVID-19 Vaccine

Immunomic Therapeutics has entered into a collaboration with PharmaJet and EpiVax to develop a nucleic acid vaccine candidate against COVID-19. This collaboration would help in developing a vaccine that is scalable, heat-stable and easy to administer using PharmaJet’s Tropis needle-free injection system.

Vir selects Samsung Biologics to Produce COVID-19 Antibodies

Vir Biotechnology has selected South Korea-based Samsung Biologics for large-scale production of antibodies to potentially treat Covid-19. Under the terms of the collaboration, Samsung Biologics would provide the manufacturing services for Vir’s monoclonal antibody (mAb) programme targeting the novel coronavirus, SARS-CoV-2. Vir’s lead mAb candidates, VIR-7831 and VIR-7832, had showed high affinity for the spike protein of SARS-CoV-2 and ability

Eli Lilly to Begin Testing RA Drug Olumiant and an Anti-Ang2 Drug in COVID-19 Patients

Eli Lilly plans to explore the use of its rheumatoid arthritis drug i.e.,  Olumiant (oral JAK1/JAK2 inhibitor)  as a treatment for hospitalized patients with COVID-19. Olumiant (Baricitinib) is approved in more than 65 countries as a treatment for adults with moderately to severely active rheumatoid arthritis. The clinical trial of  Olumiant for COVID-19 would begin this month and results are expected within the next two months.

Moreover, the company is planning to advance LY3127804, an investigational selective monoclonal antibody against Angiopoietin 2 (Ang2), to Phase II testing in pneumonia patients hospitalized with COVID-19 who are at a higher risk of progressing to Acute Respiratory Distress Syndrome (ARDS). Ang2 is known to be elevated in ARDS patients and Lilly will test whether inhibiting the effects of Ang2 with a monoclonal antibody can reduce the progression to ARDS or the need for mechanical ventilation in COVID-19 patients

Promising Clinical Trial Results of Gilead Sciences’ Antiviral Drug Remdesivir for COVID-19

Gilead Sciences Inc.’s experimental drug i.e. remdesivir has shown the promise results in early analysis. All the patients received remdesivir for up to 10 days on a compassionate use basis. The clinical trial demonstrated the clinical improvement was observed in 36 of 53 patients (68%) over the 18 days with 17 of the 30 patients on mechanical ventilation being able to get off the breathing device. Almost half of the patients studied were ultimately discharged, while 13% died. Mortality was highest among those who were on a ventilator, with 18% of them dying. Measurement of efficacy will require ongoing randomized, placebo-controlled trials of remdesivir therapy

FDA Approves Rutgers’ Saliva Test for COVID-19

The diagnostic saliva test developed by RUCDR Infinite Biologics with Spectrum Solutions and Accurate Diagnostic Labs (ADL) has received the Emergency Use Authorization (EUA) from the U.S. Food and Drug Administration (FDA). This test involves the use of the saliva for the diagnosis of the COVID-19.

This test has eliminated the need for collecting the sample through nasopharyngeal or oropharyngeal as the current COVID 19 diagnostic test requires a swab from deep in the nasal passages or the back of the throat. It puts the healthcare workers at risk of catching an infection. The diagnostic saliva test uses easy-to-collect saliva samples instead of the more difficult deep nose swabs in comparison to the existing diagnostic tests and would reduce the risk of healthcare workers from getting the infection.

Incorrect recommendations or information regarding the Novel Coronavirus (COVID-19)

by

Incorrect Recommendations or Information Regarding the Novel Coronavirus (COVID-19)

Now-a-days the several recommendations and information regarding the (COVID-19) coronavirus are being shared on social media including Facebook, WhatsApp, twitters, and others. A wide majority of these tips and information is based on false or unsubstantiated claims.

The Geneva health authorities have provided the list of the incorrect recommendations or information regarding the (COVID-19) coronavirus being shared. Here are the key list of these incorrect recommendations or information as follows:

Does a person without symptoms carrying the coronavirus is contagious?

According to the studies, people without symptoms are not the potential sources of contamination. The coronavirus infection spread mainly through respiratory droplets expelled by the people who cough. Sick people are most contagious when they are most symptomatic. There is no sufficient studies regarding the whether asymptomatic people infected with the new coronavirus are contagious or how long they are contagious before symptoms appear.

Will the virus die if exposed to temperatures of 26-27°C?

There are not any studies confirming that the climate or temperatures have an impact on the spread of coronavirus. Thus, it is impossible to say that spring or summer heat can literally kill a virus.

Does hot liquid neutralizes the virus?

It has been observed that drinking hot water or the frequency of water consumption has no effect on the coronavirus. It is not necessary to change the temperature of the water you drink. It is essential to drink water not just for killing the coronavirus.

Can coronavirus survive on inert surfaces for about 6 to 12 hours?

Various studies have shown that the coronaviruses can exist on surfaces from up to a few hours to several days depending on the different parameters such as surface type, temperature or humidity.

Does eating more ginger, garlic, pepper, etc. protects against coronavirus?

Eating ginger, garlic, pepper does not fight specifically against the coronavirus. These foods have virtues for the body.

One must hold your breath to find out if you are infected with the coronavirus. Holding one’s breath for more than 10 seconds without coughing, discomfort, congestion or tightness would prove that there is no fibrosis in the lungs and therefore no infection.

There is no scientific evidence to support this assertion. Only a laboratory test can confirm infection with the new coronavirus.

Does drinking water and gargling cure COVID-19?

Saltwater is effective in relieving the sore throat. People are advised to drink water to stay hydrated when they are sick with the flu or the novel coronavirus. Drinking does not eliminate the coronavirus in any way.

Dogs and cats can transmit the coronavirus?

There are not any studies demonstrating the transmission of the coronavirus through the dogs and cats.

Rinsing the nose regularly protects against coronavirus infection?

There are not any studies demonstrating the rinsing your nose with a saline solution protects against coronavirus infection.

Does coronavirus only affect vulnerable people?

Coronavirus can affect the people of any age-group. Elderly people and people with pre-existing conditions such as asthma, diabetes, chronic lung disease, cancer, heart disease, etc are at high risk of developing the coronavirus infection. Hence, people are advised to take measures to protect themselves from the virus through social distance of at least 2 meters, regular and meticulous hand washing, good respiratory hygiene, etc.

Are antibiotics effective in preventing and treating coronavirus infection?

Antibiotics do not work against viruses but are effective against only bacteria. The antibiotics should not be used as a means of prevention or treatment. If one is hospitalized for infection with CoV-2-CASR then one can receive antibiotics as the bacterial co-infection is possible.

Can Chloroquine cures COVID-19?

There is no drug effective for the treatment of COVID-19. Some treatments are tested in numerous research protocols worldwide. Hence, Chloroquine treatment is currently reserved for patients in hospital settings or as part of a research protocol.

Are fabric masks an efficient substitute for surgical masks?

Fabric masks not efficient substitutes for surgical masks. In fact, surgical masks are the only masks where there is scientific data regarding filtration efficiency and airtightness.  Fabric masks or other hand-made masks do not provide the bearer with any proven protection against coronavirus. Further, it is recommended that medical masks must be worn only by health staff members. FFP2 masks are required only if the presence of COVID-19 is suspected in a patient and if a high level of aerosol formation is expected during a medical procedure. Healthy people should not wear medical masks or surgical masks in the public. Healthy people must prefer fabric masks in the public.

Impact of Coronavirus (COVID19) on India Pharmaceuticals

by

Impact of Coronavirus (COVID19) on India Pharmaceuticals

India is one of the largest providers of generic drugs worldwide. India pharmaceutical industry supplies approximately 50% of vaccines worldwide, 40% of generics in the United States and 25% of all medicines in the United Kingdom. India exports bulk drugs, intermediates, drug formulations, biologicals, Ayush & herbal products, and surgicals to various countries.

According to the India Brand Equity Foundation (IBEF), the Indian pharmaceutical sector had a market size of USD 33 Billion in 2017. India’s pharmaceutical exports had witnessed an increase from USD 19.14 Billion in 2019 to USD 17.27 billion in 2018.

The novel coronavirus (COVID-19) outbreak had a negative impact on the India pharmaceutical industry in the following ways:

  • India has restricted the export of several drugs such as paracetamol, antibiotics such as tinidazole and erythromycin, hormone progesterone, which is used in the contraceptive pill, and vitamins B12, B1 and B6. These drugs account for approximately 10% of all India’s pharmaceutical exports.
  • The Indian government have imposed limits on the export of 26 pharmaceutical ingredients
  • Indian pharmaceutical companies are now close to exhausting their supply of raw materials such as active pharmaceutical ingredients (APIs). Moreover, the inventories related to the pharmaceutical ingredients are running low.
  • Several pharmaceutical companies who have contracts with domestic clients and various state governments to supply medicines have been crippled, as manufacturing has come to a halt due to a shortage of raw materials from China
  • Pharmaceutical companies are not able to procure pharmaceutical ingredients for Mintelukast, used for asthma, pain medication Nimesulide, and Amoxicillin, Ofloxaicin, and Chloramphenicol, which are used to treat bacterial infections, and antibiotic Metronidazole
  • Small and medium companies have been most  affected as they depend on traders and keep lower inventory
  • There is a drastic increase of 20-30% in the prices of raw materials used in medicines like Amoxicillin and Paracetamol.
  • The pharmaceutical logistics is facing the difficulties in receiving the raw material from other parts of the country

Coronavirus Outbreak

by

Coronavirus Outbreak

Coronaviruses Description

Coronaviruses are a family of viruses that lead to respiratory illness, including the Middle East respiratory syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). It is common in many different species of animals, including camels, cattle, cats, and bats. Rarely, animal coronaviruses can infect people and then spread between people such as with MERS-CoV, SARS-CoV, and now with this new virus (named SARS-CoV-2). The SARS-CoV-2 virus is a betacoronavirus, like MERS-CoV and SARS-CoV.  All three of these viruses have their origins in bats. Similar infections are caused by human alpha and beta coronaviruses such as 229E, NL63, OC43, and HKU1.

The symptoms associated with coronavirus are the common cold, such as running nose, headache, cough, fever, and sore throat. Viruses can spread from human contact with animals. According to the World Health Organisation (WHO), scientists think MERS started in camels. Officials do not yet know what animal may have caused the current outbreak in Wuhan.

Human-to-human transmission has been confirmed for the Wuhan coronavirus, but depending on how virulent the virus is, a cough, sneeze or handshake could cause exposure. The virus can also be transmitted by touching something an infected person has touched and then touching your mouth, nose or eyes. Caregivers can sometimes be exposed by handling a patient’s waste, according to the Centers for Disease Control and Prevention (CDC). Furthermore, SARS and MERS were largely transmitted inside hospitals. Some people are also considered to be “super spreaders.”

Current Scenario

The novel coronavirus (COVID-19) was first discovered in Wuhan, China in December 2019, since then, it has affected more than 400,000 people and caused 18,440 deaths according to the World Health Organization (WHO)’s recent situation report.

The seafood market of Wuhan was identified as the suspected hub of the coronavirus outbreak by the United States Centers for Disease Control and Prevention (CDC).  Now, there have been more new cases reported from countries outside of China than from China. Two new countries/territories/areas from the Western Pacific Region and the Eastern Mediterranean Region have reported cases of COVID-19.

The mysterious novel coronavirus outbreak was identified by Chinese authorities on January 7 and since named COVID-19, is a new strain that had not been previously identified in humans. The coronavirus (COVID-19) outbreak poses a significant life-threatening and economic risk throughout the world. Over 414,179 cases have been diagnosed across 48 countries, resulting in over 18,440 reported deaths. As far as concern, due to this contagious coronavirus outbreak death has been confirmed in Hong Kong, the Philippines, Japan, France, Iran, Taiwan, South Korea, and other countries. On 31st January 2020, officially WHO has declared it a global health emergency, due to increases number of infectious cases has been confirmed in countries such as South Korea, Afghanistan, France, UAE, and many more countries.

The mortality rate is mostly within 2%~3%, well in line with the WHO official estimate. For example, MERS, SARS and the Wuhan coronavirus appear to cause more severe disease in older people Age group 60-69 years old at 3.6%, 50-59 years old at 1.4% & least 40-49 years old at 0.4%, though uncertainty remains around the latest outbreak. Of the cases of Wuhan coronavirus reported so far, none are yet confirmed to be among children.

Treatment Landscape

Several vaccines, antibiotics & anti-retroviral drugs such as FTNX-1800 (Tonix Pharmaceuticals), Leronlimab (CytoDyn), etc. are undergoing the clinical trials for coronavirus outbreak. Apart from this novel therapies, supportive therapy is also recommended including over the counter medicine for a sore throat, fever & pain reliever medications, etc. to relieve the symptoms, if happens. Additionally, drink plenty of fluids, get rest and sleep as much as possible is recommended.

Government Initiatives

The government has taken initiative to allocate the emergency funds for improving public health to curb the current global coronavirus outbreak. For instances, The Trump Administration is looking to allocate approximately $2.5 billion in emergency funds to help prepare the country should the current coronavirus crisis become a public health care threat in the U.S. Other governments and global health authorities are taking similarly aggressive steps to prepare for the virus’s continued spread. Furthermore, the UK government like Health Secretary Matt Hancock has announced that £20m in Government funding will be given to the Coalition for Epidemic Preparedness Innovations (CEPI) to advance programmes targeting the coronavirus.

Novel Coronavirus (COVID-19) Recent Updates

by

Novel Coronavirus (COVID-19) Updates

FDA Approves First Rapid Point-Of-Care COVID-19 Diagnostic Test

Sunnyvale-based molecular diagnostic company Cepheid received FDA approval for the first rapid coronavirus test with a 45-minute detection time. This test will be used primarily in hospitals and emergency rooms.

Abbott receives FDA Emergency Use Authorization and Launches Test to Detect Novel Coronavirus

Abbott has received FDA emergency use authorization for a molecular test for novel coronavirus (COVID-19). The Abbott m2000 RealTime System is a molecular solution featuring a broad menu of tests, including ones for infectious diseases. The platform uses polymerase chain reaction (PCR) technology, which amplifies a single piece (or few copies of a piece) of DNA to quickly and accurately diagnose a patient. The m2000 is currently used in labs around the world.

Roche begins shipments of first 400,000 COVID-19 tests to laboratories across the US to begin patient testing under FDA Emergency Use Authorization

Roche plans to ship an additional 400,000 tests per week to the laboratory testing sites across the nation that are set up to run the test immediately under the guidelines of the FDA Emergency Use Authorization (EUA). The Cobas SARS-CoV-2 Test provides reliable and high-quality results for clinical decision-making for the improved management of COVID-19 patients and to reduce the risk of SARS-CoV-2 (coronavirus) infection. These highly automated tests provide results in 3-½ hours.

Eli Lilly teams with Indiana Health Agency to provide speedy Coronavirus Testing to Indiana Residents

Eli Lilly teams with the Indiana State Department of Health (ISDH) to rapidly expand and accelerate testing for the SARS-CoV-2 coronavirus in Indiana.

Thermo Fisher plans to produce up to 5 million of a new test to detect the Novel Coronavirus

Thermo Fisher, the largest maker of scientific tools, plans to produce up to 5 million of a new test to detect the novel coronavirus that causes Covid-19. The Food and Drug Administration granted the new test an emergency use authorization status.

*Emergency Use Authorization (EUA): Under section 564 of the Federal Food, Drug, and Cosmetic Act (FD&C Act), the FDA Commissioner may allow unapproved medical products or unapproved uses of approved medical products to be used in an emergency to diagnose, treat, or prevent serious or life-threatening diseases or conditions caused by CBRN threat agents when there are no adequate, approved, and available alternatives.