Koselugo (selumetinib):AstraZeneca plc and Merck & Co., Inc.
Koselugo (selumetinib) is the first drug approved by the FDA for the treatment of pediatric patients, 2 years of age and older, with neurofibromatosis type 1 (NF1), a genetic disorder of the nervous system causing tumors to grow on nerves. The drug is an inhibitor of mitogen-activated protein kinases 1 and 2 (MEK1/2). Koselugo was granted with many designations: US FDA Breakthrough Therapy Designation in April 2019, Rare Pediatric Disease Designation in December 2019, Orphan Drug Designation in February 2018, EU orphan designation in August 2018 and Swissmedic Orphan Drug Status in December 2018 for the treatment of pediatric patients with NF1 PN.
Tukysa (tucatinib): Seattle Genetics
Tukysa (tucatinib) is an oral, small-molecule tyrosine kinase inhibitor (TKI) of HER2, a protein that contributes to cancer cell growth. The drug is approved in combination with trastuzumab and capecitabine for the treatment of adult patients with advanced unresectable or metastatic HER2-positive breast cancer, including patients with brain metastases, who have received one or more prior anti-HER2-based regimens in the metastatic setting. Tukysa was approved by different regulatory bodies such as the US Food and Drug Administration (FDA) in collaboration with Health Canada, Australian Therapeutic Goods Administration (TGA), Swissmedic (SMC, Switzerland), and Health Sciences Authority (HSA, Singapore) in April 2020.
Pemazyre (pemigatinib): Innovent Biologics, Inc.
Pemazyre (pemigatinib) is the first and only FDA-approved treatment for the treatment of adults with previously treated, unresectable locally advanced, or metastatic cholangiocarcinoma. Pemazyre is a potent, selective, oral inhibitor of Fibroblast growth factor receptor (FGFR) 1, 2, and 3. The drug is marketed by Incyte in the United States. Incyte has granted Innovent Biologics rights to develop and commercialize pemigatinib in hematology and oncology in Mainland China, Hong Kong, Macau, and Taiwan. Incyte has retained all other rights to develop and commercialize pemigatinib outside of the United States.
Ongentys (opicapone): Neurocrine Biosciences, Inc.
Ongentys (opicapone) is the first and only approved Catechol-O-methyltransferase (COMT) inhibitor indicated for the treatment of Parkinson’s disease with off episodes, used as an adjunctive treatment to levodopa and carbidopa. It was developed by Portuguese pharmaceutical group BIAL. Neurocrine Biosciences entered an exclusive licensing agreement with BIAL for the development and commercialization of opicapone in North America in September 2017. BIAL is currently responsible for the marketing of Ongentys in the United Kingdom, Italy, Spain, Germany, and Portugal.
Multiple sclerosis (MS) is a condition that can affect the brain and spinal cord, causing a wide range of potential symptoms, including problems with vision, arm or leg movement, sensation, or balance. It is a chronic autoimmune inflammatory disease of the central nervous system that damage and scars the sheath, and potentially the underlying nerves. Multiple sclerosis is affecting 2.3 million people worldwide, with females more affected than males.
According to the National Institute for Neurological Disorders and Stroke (NINDS), approximately, 250,000-350,000 people are suffering from the Multiple Sclerosis in the United States. The majority of the people with multiple sclerosis are diagnosed between the ages of 20 and 50, with at least two to three times more women than men being diagnosed with the disease. The most common symptoms associated with MS include fatigue, difficulty walking, vision problems, problems controlling the bladder, etc. The average life expectancy is slightly reduced for people with MS. The progress, severity, and specific symptoms of MS in any one person cannot yet be predicted.
There are various diversify companies involved in the discovery and development of a potentially robust clinical pipeline for the treatment of Multiple Sclerosis. Merck Healthcare KGaA, Novartis, Sanofi, TG Therapeutic, Biogen, MedDay Pharmaceuticals SA, and Hoffmann-La Roche are the major market players
Actelion (Ponesimod)
Ponesimod is an investigational selective sphingosine-1-phosphate receptor 1 (S1P1) modulator that inhibits S1P protein activity and reduce the number of circulating lymphocytes that can cross the blood-brain barrier. The Janssen Pharmaceutical Companies of Johnson & Johnson (Janssen) had submitted the New Drug Application (NDA) to the U.S. Food and Drug Administration (FDA) for ponesimod for the treatment of adult patients with relapsing multiple sclerosis (MS).
Merck Healthcare KGaA (Evobrutinib)
Evobrutinib is an investigational oral inhibitor of Bruton’s tyrosine kinase (BTK) which is thought to be important in the development and functioning of various immune cells including B lymphocytes and macrophages. Currently, clinical research study is ongoing on Evobrutinib. The study would evaluate the efficacy and safety of evobrutinib administered orally twice daily versus Teriflunomide (Aubagio), administered orally once daily in participants with Relapsing Multiple Sclerosis (RMS).
Hoffmann-La Roche (Ocrelizumab)
Ocrelizumab is a humanized monoclonal antibody that selectively targets the CD20-positive B-cells implicated in the inflammatory and neurodegenerative processes of multiple sclerosis (MS), to effectively impact disease progression while maintaining immunosurveillance.
A clinical trial of Phase-III study is being conducted to treat MS. This is a single arm, open label, multicenter extension study in participants on ocrelizumab therapy at the end of Treatment period of the Roche P-trial. Participants would receive the treatment with ocrelizumab as single 600 mg infusions every 24 weeks for two years.
TG Therapeutics, Inc. (Ublituximab)
Ublituximab (TG-1101) is a monoclonal antibody that targets CD20 positive B-cells, a component of the body’s immune system. When it attaches to the B-cell it triggers immune reactions (including antibody-dependent cellular cytotoxicity, ADCC, and antibody-dependent cellular phagocytosis that result in the death of the targeted B-cell).
While ublituximab is a novel patented molecule, it’s mechanism of action is similar to the approved anti-CD20 monoclonal antibodies. Ublituximab has been bioengineered to remove certain sugar molecules from the anti-CD20 antibody, which are naturally occurring. The removal of the sugar molecules in a process called glycoengineering have enhanced the potency of ublituximab with data showing 50-100x greater activity than non-bioengineered anti-CD20 antibodies.
MedDay Pharmaceuticals SA (MD1003)
MD1003 is a highly concentrated oral formulation of biotin currently under clinical investigation as a treatment for primary and secondary progressive multiple sclerosis (PPMS and SPMS). It is being developed by MedDay. It is a promising treatment that exhibits the pro-myelinogenic effects and enhances the supply of energy for nerve impulse transmission.
Biogen (Opicinumab)
Opicinumab is a human monoclonal antibody that targets LINGO-1, a protein that suppresses the redevelopment of axons (brain cells that send functional information throughout the body) and re-formation of myelin sheaths (fibers that protect the axons). Axons and myelin sheaths are lost or damaged in patients with MS, leading to loss of physical and cognitive function. By blocking LINGO-1, opicinumab is formulated to promote regeneration of axons and myelin.
The Phase II, double-blind AFFINITY study is assessing the effectiveness of opicinumab as an add-on therapy in people with relapsing or secondary-progressive forms of MS (RMS or SPMS).
Novartis (Ofatumumab)
Ofatumumab is a fully human anti-CD20 monoclonal antibody (mAb) self-administered by a once-monthly subcutaneous injection in development for RMS. Ofatumumab works by binding to the CD20 molecule on the B-cell surface, distinct from that of other anti-CD20 antibodies, and induces potent B-cell lysis and depletion. The selective mechanism of action and subcutaneous administration of ofatumumab allows precise delivery to the lymph nodes, where B-cell depletion in MS is needed, while sparing those in the spleen that help maintain protective immunity. Once-monthly dosing of ofatumumab also allows faster repletion of B-cells, and offers more flexibility as no first dose observations or laboratory monitoring is required. Novartis obtained rights for ofatumumab from Genmab in all indications, including MS, in December 2015.
Novartis (BAF312)
Siponimod is an investigational, selective modulator of specific subtypes of the sphingosine-1-phosphate (S1P) receptor. Siponimod binds to the S1P1 sub-receptor on lymphocytes, which prevents them from entering the central nervous system (CNS) of patients with multiple sclerosis. This leads to the anti-inflammatory effects of siponimod. Siponimod also enters the CNS and binds to the S1P5 sub-receptor on specific cells in the CNS (oligodendrocytes and astrocytes). By binding to these specific receptors, siponimod has the potential to modulate damaging cell activity, and preclinical studies suggest that it may prevent synaptic neurodegeneration and promote remyelination in the central nervous system.
Sanofi (Teriflunomide)
Teriflunomide is the first original ‘once-daily’ oral ‘disease modifying therapy’ (DMT) for Multiple Sclerosis. It offers an effective, safe and a convenient option that is indicated as a first-line treatment for relapsing forms of Multiple Sclerosis that must be taken once a day, with or without food.
Emerging Pipeline Landscape of Multiple Sclerosis (MS)
Every year 30 May, is celebrated as the World Multiple Sclerosis Day to raise awareness regarding Multiple Sclerosis. It celebrates solidarity and hope for the future. It makes people closer free to move closer to a world free of MS.
Purpose of World Multiple Sclerosis Day
Building communities that support and nurture people affected by MS
Promoting self-care and healthy living with MS
Lobbying decision-makers for better services and effective treatment for people with MS
Connecting people affected by MS to MS research.
Multiple sclerosis (MS) is a potentially disabling disease of the brain and spinal cord that attacks the protective sheath (myelin) that covers nerve fibers and causes communication problems between the brain and the rest of the body. It causes permanent damage or deterioration of the nerves.
Cystic Fibrosis is an autosomal, recessive inheritable genetic disease that causes severe damage to the respiratory and digestive systems. This damage often results from a buildup of thick, sticky mucus in the organs. It occurs as a result of a defect in what’s called the “cystic fibrosis transmembrane conductance regulator” gene, or CFTR gene. This gene controls the movement of water and salt in and out of your body’s cells. A sudden mutation causes the abnormality in CFTR gene and commonly affected the various organs including the lungs, pancreas, liver, and intestines. The symptoms of cystic fibrosis can vary depending on the person and the severity of the condition. The age at which symptoms develop can also differ. Symptoms may appear at infancy, but for other children, symptoms may not begin until after puberty or even later in life. As time passes, the symptoms associated with the disease may get better or worse.
Around 70,000-80,000 people worldwide are suffering from the Cystic Fibrosis. Cystic Fibrosis has the highest incidence and prevalence in Caucasian populations and is less common in other population groups. Every year, around 1,000 people are diagnosed with Cystic Fibrosis in the United States.
Several pharmaceutical companies are developing the novel drugs for the treatment of Cystic Fibrosis. The pipeline landscape of the cystic fibrosis is robust with the involvement of several drugs such as vancomycin hydrochloride inhalation powder, OligoG, ELX-02 and VX-561 etc.
The pharmaceutical companies involved in developing emerging drugs against Cystic Fibrosis are as follows:
Savara Pharmaceuticals (AeroVanc)
AeroVanc (vancomycin hydrochloride inhalation powder) is an inhaled dry powder form of vancomycin for the treatment of the persistent (MRSA) lung infection in people living with Cystic Fibrosis. AeroVanc is in Phase III stage of development for the treatment of the Methicillin-resistant Staphylococcus aureus (MRSA) lung infection in Cystic Fibrosis. AeroVanc is effective in improving the clinical efficacy, and reducing the adverse effects due to lessor systemic drug exposure in comparison to the intravenous antibiotic treatment.
AlgiPharma (OligoG)
OligoG is a dry powder drug that has been shown to decrease the thickness of mucus in the lungs and may help individuals with cystic fibrosis clear mucus easier. OligoG help in improving the effectiveness of some antibiotics. It is administered using a dry powder inhaler and also developed as a liquid for use with a nebulizer
Currently, Phase IIb trial is currently running in Australia, with another Phase 2b scheduled to start in Europe H1 2020. The drug candidate OligoG for Cystic Fibrosis has Orphan Drug designation from both the European Medicines Agency and the FDA
Eloxx Pharmaceuticals, Inc. (ELX-02)
ELX-02, is a small molecule drug candidate designed to restore production of full-length functional proteins. It is in the early stages of clinical development focusing on cystic fibrosis and nephropathic cystinosis. ELX-02 is an investigational drug that has not been approved by any global regulatory body.
Furthermore, ELX-02, is a eukaryotic ribosomal selective glycoside (ERSG) designed to increase the read-through activity in patients with nonsense mutations and enable the production of sufficient amounts of full-length functional protein to restore activity.
Its Phase II program has been given a score of “high priority” by the European Cystic Fibrosis Society-Clinical Trial Network (ECFS-CTN).
Laurent Pharmaceuticals Inc. (LAU-7b)
LAU-7b is a novel and improved solid dosage form of fenretinide, requiring. once-a-day oral administration. It was recently tested in adult patients with Cystic Fibrosis in a dose-ascending where Phase Ib study, showing a good safety and tolerability, and promising pharmacokinetic and pharmacodynamic results.
The company is currently recruiting patients for its Phase II safety and efficacy study in adult patients with Cystic Fibrosis. The goal of the Phase II trial is to evaluate LAU-7b’s effect on the preservation of lung function, by reducing persistent unresolved inflammation in the lung and stimulating its return to homeostasis. The study would enroll 136 adults with Cystic Fibrosis for a treatment duration of 6 months and will involve more than 30 clinical sites in the USA and Canada.
Corbus Pharmaceuticals Inc. (Lenabasum)
Lenabasum is a rationally-designed, oral, small-molecule that selectively binds as an agonist to the cannabinoid receptor type 2 (CB2). It has a direct effect on fibroblasts to limit the production of fibrogenic growth factors and extracellular connective tissue that lead to tissue fibrosis. Lenabasum treatment has resulted in lowering the and longer time to pulmonary exacerbations in Phase II cystic fibrosis study. The Lenabasum had demonstrated the safety and tolerability profile in clinical studies. It has demonstrated safety and tolerability profile in clinical studies
Vertex Pharmaceuticals Incorporated (VX-561)
VX-561 is a deuterated form of ivacaftor that replaces one or more hydrogen atoms with deuterium. It is designed to keep CFTR proteins at the cell surface open longer to improve the flow of salt and water across the cell membrane, which helps hydrate and clear mucus from the airways.
VX-121 and tezacaftor act by increasing the amount of mature protein at the cell surface by targeting the processing and trafficking defect of the CFTR protein. VX-561 (deuterated ivacaftor) is designed to keep CFTR proteins at the cell surface open longer to improve the flow of salt and water across the cell membrane, which helps hydrate and clear mucus from the airways.
SolAeroMed Inc (S-1226)
S-1226 is a novel fast-acting bronchodilator, with airway lubricant properties to remove mucus. It acts as a cough suppressant and is an anti-inflammatory agent. S-1226 is based on amalgation of Perflubron (a synthetic surfactant derivative) and carbon dioxide. When combined in inhalation therapy as S-1226 delivered by nebulization these compounds offer significant promise to treat respiratory diseases where breathing is compromised due to bronchoconstriction, excess mucus production, and/or impaired mucus motility. It has demonstrated the safety and efficacy for the treatment of Cystic Fibrosis.
Pre-eclampsia is a leading cause of maternal mortality and prematurity. It is formerly called toxemia, which is when a pregnant woman has high blood pressure, protein in her urine, and swelling in her legs, feet, and hands. It can range from mild to severe. It usually happens late in the pregnancy after 20 weeks of pregnancy, though it can come earlier or just after delivery. In addition, there are several complications associated with preeclampsia such as HELLP syndrome, poor blood flow to the placenta & placental abruption, etc. Preeclampsia can lead to eclampsia, a serious condition that can have health risks for mom and baby and, in rare cases, cause death. Women with preeclampsia who have seizures have eclampsia. Approximately around 5% of all pregnant women get affected by preeclampsia.
The symptoms often begin after 34 weeks. Symptoms develop after birth, usually within 48 hours of delivery in few cases. They tend to go away on their own but can last up to 12 weeks after birth. In addition, the common symptoms develop such as edema, protein in the urine, and high blood pressure, preeclampsia symptoms include weight gain, belly pain, severe headaches, changes in reflexes, peeing less or not at all, dizziness, severe vomiting and nausea, vision changes like flashing lights, floaters, or blurry vision
Yet, the exact cause of preeclampsia is unidentified. But most of them say this problem happens with the development of the placenta because the blood vessels that supply it are narrower than normal and respond differently to hormonal signals. Because the blood vessels are narrower than normal, blood flow is limited. Several factors such as the history of preeclampsia, age, race, chronic hypertension, first pregnancy, obesity, and multiple pregnancies increase the chances of developing the preeclampsia
Preeclampsia is diagnosed through the following tests:
Hypertension: The woman’s blood pressure is raised above 140/90 millimeters of mercury is abnormal in pregnancy.
Proteinuria: Protein is detected in the urine is indicated for the severity of the condition.
The doctor may also recommend some further diagnostic tests:
Blood tests – to assess the kidney and liver functions.
Fetal ultrasound – to monitor the baby’s progress.
Non-stress test – the doctor checks how the baby’s heartbeat reacts when they move. If the heartbeat increases 15 beats or more a minute for at least 15 seconds twice every 20 minutes, it is an indication that everything is normal
Recently, UniSA biomedical engineer Professor Benjamin Thierry developed a range of solid-state sensing and wearable technologies capable of diagnosing conditions including preeclampsia, epilepsy, fetal arrhythmias, and heart attacks. These wearables use a cutting-edge solid-state sensing technology called Field-Effect Transistors, which can measure bioelectric signals with extreme sensitivity when implemented at the nanoscale.”
However, Preeclampsia is not cured until the baby is delivered. Hence, the mother’s blood pressure comes down, she is at a greater risk of stroke, severe bleeding, separation of the placenta separates from the uterus and seizures. In some cases, especially if the preeclampsia started early, the delivery may not be the best option for the fetus.
Supportive therapy is recommended for the women Preeclampsia. Supportive therapy is as follows:
Antihypertensives: These are used to lower blood pressure.
Anticonvulsants: In severe cases, these drugs are used to prevent a first seizure. The doctor may prescribe magnesium sulfate.
Corticosteroids: If the mother has preeclampsia or HELLP syndrome (see below) these drugs can improve platelet and liver functioning. This can prolong pregnancy.
While preeclampsia cannot be fully prevented, there are significant steps a woman can follow to avoid the moderate factors contribute to high blood pressure.
These may include:
drinking between 6 and 8 glasses of water every day
avoiding fried or processed food
excluding added salt from the diet
regular exercise
avoiding alcohol and caffeine intake
keeping the feet elevated a few times per day
resting
supplements and medications as prescribed by your doctor
Moderna Vaccine’s Progress, Excites COVID-19 Markets
Moderna Inc’s experimental COVID-19 vaccine, the first to be tested in the United States, produced protective antibodies in a small group of healthy volunteers. However, the data comes from eight people who took part in a 45-subject safety trial that kicked off in March. Afterward, Phase I trial results of the vaccine, mRNA-1273, have been found promising. On May 7, the company has received regulatory clearance for the Phase II trial that would involve a much larger sample size. The imminent Phase II study start is a crucial step forward as we continue to advance the clinical development of mRNA-1273, our vaccine candidate against SARS-CoV-2. With the goal of starting the mRNA-1273 pivotal Phase III study early this summer, Moderna is now preparing to potentially have its first BLA approved as soon as 2021. In addition, Moderna launched a $1.34 billion share offering at an offer price of $76 per share. The company had earlier said it plans to sell $1.25 billion in common stock to raise money for vaccine development and manufacturing.
Canada Approves the First Clinical Trial for potential Covid-19 Vaccine
The race is on to find a vaccine for COVID-19 and Canada’s government may have taken the lead after its national drug regulator cleared a plan to begin studying the front-running candidate. This investigation drug is an adenovirus-based vaccine developed jointly by China’s CanSino Biological and the National Research Council of Canada and is one of eight to have made it to the clinic, and is already in phase II development in China.
Gilead signed non-exclusive licensing agreements with five companies based out of India and Pakistan for their investigational drug remdesivir, to treat COVID-19 patients. Gilead signed licenses with Cipla, Jubilant Lifesciences, Hetero Labs, Mylan, and Ferozsons Labs. Under the agreement for remdesivir, Gilead would transfer its technology on how the API and formulations are developed to the companies and distribute it in 127 countries including India.
The deal would ensure accessibility and affordability of remdesivir in especially lower income countries with poor health infrastructure. Besides India, this license agreement extends to countries such as Afghanistan, Bhutan, Cambodia, South Africa and Egypt to name a few. It does not extend to larger and more developed countries such as US, UK, Europe, China, Australia amongst others. Hence, the drug was given emergency use authorization (EUA) by the USFDA for treating COVID-19 patients, but is yet to be formally approved by the drug regulator. Further, this is the second voluntary license agreement that Gilead has signed.
China Tests Coronavirus Drug That Aims to Stop Pandemic Sans Vaccine
A Chinese laboratory has been developing a drug it believes has the power to bring the coronavirus (COVID-19) pandemic to a halt. A drug being tested by scientists at China’s prestigious Peking University could not only shorten the recovery time for those infected but even offer short-term immunity from the virus. It is isolated from the blood of 60 recovered patients. The drug has been successful at the animal testing stage. The injection of the neutralizing antibodies into infected mice resulted in reducing the viral load was reduced by a factor of 2,500 This potential drug has a therapeutic effect.
Oxford’s Jenner Institute & AstraZeneca Collaborate Together
Oxford’s Jenner Institute had entered into the collaboration with the AstraZeneca for the development of the vaccine. The experimental vaccine, known as ChAdOx1 nCoV-19, is one of the front runners in the global race to provide protection against the new coronavirus causing the COVID-19 pandemic.
Microsoft & UnitedHealth Launch COVID-19 Screening App For The Workplace
Microsoft and UnitedHealth Group are launching a free smartphone app that businesses and employees can use to digitally screen for COVID-19 symptoms and clear those who can return to work. Based on guidelines from the Centers for Disease Control and Prevention, the ProtectWell app uses Microsoft’s chatbot interface to ask the user a series of daily questions, such as whether they have had a fever or any respiratory symptoms or whether they’ve been in contact with anyone diagnosed with COVID-19.
Fitbit to Develop Emergency COVID-19 Ventilator
Fitbit aims to wield its fitness-focused supply chain to start building its own COVID-19 ventilator and plans to submit its designs to the FDA in the near future. This device would include more features than the typical emergency alternatives developed in response to the spreading coronavirus pandemic, which are largely made to be built quickly and at scale using off-the-shelf components and mechanically deliver puffs of air at a fixed rate.
The importance of diagnostic market increased significantly amid the coronavirus pandemic outbreak, by providing a new potential growth opportunity pocket which enables the diagnostic companies to launch and commercialized new product in the Indian market to save the lives of thousand people, by ramping up the diagnosis process through identification of the virus and treatment. The major drivers are lifestyle diseases rising, improving per capita, increasing awareness, and increasing payer coverage. Apart from it, they are certain influencing factors such as accessibility, lack of specialists, lack of standardization & affordability still a concern.
Out of many private companies, recently the government had allowed two private companies include Indian company MyLab and German firm Altona Diagnostics – to supply COVID-19 test kits to both government as well as private testing laboratories in India. In addition, two south Korean firms, Seegene and SD Biosensor have received government approval to supply RT-PCR based Novel Coronavirus (COVID-19) diagnostic kits in India.
The government has also approved 12 rapid antibody test kits for COVID-19 diagnosis companies such as BioMednomics (USA), Getein Biotech (China), Sensing Self Ltd (Singapore), Hangzhou Biotest Biotech (China), AmonMed Biotechnology Co (China), Beijing Tigsun Diagnostics Co Ltd (China), Biomaxima (Poland), CTK Biotech (USA), Hunan Lituo Biotechnology Co (China), Vivacheck Lab (China) and Wondfo (China). While, The rapid antibody test facilitate result within 30 minutes, thereby providing additional benefits. The test comes positive after 7 to 10 days of infection. While a positive test indicates exposure to COVID-19, negative does not rule out the infection.
There are several companies issued a CDSCO license in the Indian market such as Altona Diagnostics, MY LABS, Roche & Seegene, etc.
Altona Diagnostics, RealStar SARS-CoV-2 RT-PCR Kits (1.0 and U.S versions), is a reagent system, based on real-time PCR technology, for the qualitative detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These tests can be run in parallel: RealStar® Influenza Screen & Type RT-PCR Kit 4.0.etc
Mylab Discovery Solutions Pvt Ltd: PathoDetect COVID-19 Qualitative PCR ‘Made in India’ test kits
Pune based Mylab Discovery Solutions Pvt Ltd developed PathoDetect COVID-19 Qualitative PCR ‘Made in India’ test kits are capable of diagnosing a patient in two-and-a-half hours, unlike the imported kits, which currently take up to seven hours. The kits have reportedly been developed in a record time of six weeks and will reduce the cost of testing to a fourth of the current cost. It also the first Indian diagnostic kit approved by the ICMR against COVID-19.
Allplex: 2019-nCoV Assay
Allplex 2019-nCoV Assay is a multiplex Real-time PCR assay for simultaneous detection of 3 target genes of SARS-CoV-2 in a single tube. The assay is designed to detect RdRP and N genes specific for SARS-CoV-2, and E gene for all of Sarbecovirus including SARS-CoV-2. It shows PCR with high sensitivity and specificity by giving results within 1 hour and 50 minutes after extraction. It has also inserted an automatic data analyzer and LIS interlocking with Seegene Viewer. It also gives quick response and proper treatment provided by accurate test results.
Genesig: Real-Time PCR COVID-19
Genesig Real-Time PCR COVID-19 (CE) is CE-IVD marked and intended for in vitro diagnostic use in Europe. This is a rapid kit detection and exclusive to the COVID-19 strain, however not involved in the detection of other related coronavirus strains. It has high priming efficiency and a highly specific detection profile. Besides, Lyophilised components for ambient shipping. It also involved in driving accurate controls to confirm extraction and assay validity.
Roche Diagnostics: Cobas SARS CoV-2 Diagnostic Test Kit
Roche Diagnostics India has received the license from the country’s drug regulator DCGI for its ‘cobas SARS CoV-2’ diagnostic test kit, making it the first private firm to get permission to conduct coronavirus tests Since, the NIV has tested 14 privately-made kits and recommended three kits made Atona Diagnostics, MyLab, and Seegene for CDSCO license.
Commercialized Diagnostic Products
Company
Diagnostic Kit
Product Description
Altona diagnostic
RealStar SARS-CoV- 2 RT-PCR kit 1.0
Reagent system, based on real-time PCR technology, for the qualitative detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These tests can be run in parallel
MY LAB
Patho Detect
PathoDetect COVID-19 Qualitative PCR kit would cost just around one-fourth of the current procurement cost.
BGI
Real Time Fluorescent RT-PCR kit for detecting 2019-nCoV
Reagents commercially distributed as a kit to labs Can only be run in high complexity labs
Uses Taqman probes. Taqman Probes are widely used RT-PCR assay because of its sensitivity and specificity with dual quenchers for higher accuracy. With 2/3 Primer/Probe option
ABI
TaqMan 2019-nCov Control kit v1
TaqMan 2019-nCoV Control Kit v1 is a synthetic positive control that contains target sequences for each of the assays included in the TaqMan 2019-nCoV Assay Kit v1 (Cat. No. A47532). The control includes synthetic DNA target sequences for three SARS-CoV-2 genes (ORF1ab, S protein, and N protein) and the human RNase P RPPH1 gene.
HIMEDIA
Hi-PCR Coronavirus (CoVID-19) Probe PCR kit
To perform PCR on various DNA templates for numerous downstream applications. It also contains all necessary components including HiMedia’s ultra-efficient Taq Polymerase, dNTP mixture, and MgCl2 for reproducible PCR results.
HUWEL
Quantiplus Coronavirus (2019nCoV) Detection kit
The kit has a synthetic gene cloned in a plasmid as a positive control. The primers set is cross-verified for specificity with several RNA and DNA viruses and bacteria
IIT-DELHI
SYBR Green based one step QRT-PCR
First probe-free assay for COVID-19 approved by the ICMR and it will be useful for specific and affordable high throughput testing. It can easily be scaled up as it does not require fluorescent probes. Targeting large-scale deployment of the kit at affordable prices with suitable industrial partners as soon as possible.
KILPEST (BLACKBIO)
TRUPCR
Real-Time PCR Test is a molecular detection test that screens and detects Covid-19 specific genes and is confirmatory.
Genesig
Coronavirus (COVID-19) genesig Real Time PC R Assay
Rapid detection and exclusive to the COVID-19 strain Does not detect other related coronavirus strains High priming efficiency
Roche
LightMix Modular SARS and Wuhan CoV E gene
E_Sarbeco_F1 (Oligonucleotide ID) Contains ACAGGTACGTTAATAGTTAATAGCGT (5’-3’ sequence ) by using use 400 nM per reaction
Roche
LightMix Modular SARS and Wuhan CoV N gene
N_Sarbeco_F1 (Oligonucleotide ID) Contains CACATTGGCACCCGCAATC (5’-3’ sequence ) by using use 600 nM per reaction
Roche
LightMix Modular Wuhan RdRp gene
Detect Wuhan 2019 SARS-like CoV pneumonia virus Sensitivity is 3.8 copies per reaction (95% CI: 2.7–7.6) Lot release min 10 copies
Seegene
Allplex 2019-nCoV assay
Multiplex real-time PCR assay for simultaneous detection of 3 target genes of SARS-CoV-2 in a single tube Results within 1 hour and 50 minutes after extraction
May, 10-16 is the Food Allergy Awareness Week created by the Food Allergy Research and Education (FARE) to raise awareness regarding the different food allergies and improve public understanding of what can sometimes be a life-threatening condition.
The food allergy is an immune-mediated response to allergens in foods. When certain foods are eaten, or simply touched or inhaled, these sensitizing markers trigger the immune system into overdrive. The prevalence of food allergy is increasing worldwide. Likewise, more than 50 million Americans have an allergy of some kind. Food allergy symptoms are most common in babies and children, but they can appear at any age. It can develop an allergy to foods even eaten for years with no problems.
According to the Centers for Disease Control and Prevention (CDC), Food allergies are estimated to affect 4% – 6% of children and 4% of adults, which occurs when the immune system identifies a food or substance as a danger and triggers a protective response. This reaction may cause a wide range of symptoms, including Vomiting or stomach cramps, hives, shortness of breath, wheezing, repetitive cough, dizziness or feeling faint, weak pulse and anaphylaxis, etc. While any food can cause an adverse reaction, eight types of food account for about 90 percent of all reactions: such as eggs, milk, peanuts, fish, wheat, and soy. In addition, certain seeds including sesame and mustard seeds (the main ingredient in the condiment mustard), also are common food allergy triggers and considered a major allergen in some countries. Food allergy may also involve in affecting some other areas such as skin, the gastrointestinal tract, the cardiovascular system, and the respiratory tract.
Moreover, the food-related symptoms may occur within two hours of ingestion; often they start within minutes. In some very rare cases, the reaction may be delayed by four to six hours or even longer. The delayed reactions are most typically seen in children who develop eczema as a symptom of food allergy and in people with a rare allergy to red meat caused by the bite of a lone star tick.
Another type of delayed food allergy reaction stems from food protein-induced enterocolitis syndrome (FPIES), a severe gastrointestinal reaction that generally occurs two to six hours after consuming milk, soy, certain grains, and some other solid foods. It mostly occurs in young infants who are being exposed to these foods for the first time or who are being weaned.
Sometimes, the diagnosis of FPIES may be delayed. FPIES is a medical emergency that should be treated with IV rehydration. Allergists ask detailed questions about medical history and the symptoms for the diagnosis of food allergy. Various skin tests and/or blood tests are used for the detecting the food-specific immunoglobulin E (IgE) antibodies present in the body i.e. Skin- prick Test and Blood Test
Skin-Prick Tests provide results within 20 minutes. A liquid containing a tiny amount of the food allergen is placed on the skin of the arm or back and then the skin is pricked with a small, sterile probe, allowing the liquid to seep under the skin. The test, which isn’t painful but can be uncomfortable, is considered positive if a wheal develops at the site where the suspected allergen was placed. As a control, they ’ll also get a skin prick with a liquid that doesn’t contain the allergen; this should not provoke a reaction, allowing comparison between the two test sites.
Blood Tests which are less accurate than skin tests, measure the amount of IgE antibody to the specific food being tested. Results are typically come out in about a week and are reported in the numerical value.
The Food Allergy can be managed in the following ways:
To avoid consuming the food that causes problems. In addition, carefully check ingredient labels of food products.
Despite this, there are some other treatments to reduce minor and severe allergic reactions. e.g. For a minor allergic reaction, over-the-counter or prescribed antihistamines to reduce the symptoms. However, it can’t be used to treat severe allergic reactions.
For a severe allergic reaction, recommended an emergency injection of epinephrine and a trip to the emergency room. In addition, many people with allergies carry an epinephrine autoinjector (Adrenaclick, EpiPen)
During this Food Allergy Awareness Week, Whystle Launched Personalized Product Recall App to Keep Parents Informed and Families Protected. This app provides personalized safety information and up-to-the-minute recall notices, especially for up-to-date allergen recalls. Besides, every three minutes, food allergy reactions send someone to the emergency room.
Over the last few months, the coronavirus outbreak has spread to various countries such as China, South Korea, Italy, Iran, Japan, Singapore, Hong Kong, the United States, and other countries. It has endangered thousands of lives in a short span of time. Hence, several diagnostic companies have been focused on the development of promising diagnostic test products to expedite the diagnosis process as quickly as possible to save the lives of people.
The pipeline landscape of the coronavirus detection is robust with the involvement of several diagnostic test products such as PANDAA qDx SARS-CoV-2, RabWiz Ultra-Sensitive COIV-19 Viral Antigen Test Kit (ELISA) & AiroStotleCV19 (Breath VOCs), etc. Below is a list of the company and its product descriptions and key information for all the emerging diagnostic test products
Canary Health Technologies: AiroStotleCV19 (Breath VOCs)
Canary Health Technologies has developed AiroStotleCV19 (Breath VOCs), a highly sensitive, specific, non-invasive and cost-effective test using VOCs analysis as a result of oxidative stress offers a potentially powerful new approach to early diagnosis COVID-19
Aurora Biomed Inc.: SARS-COV-2 Detection Kit
SARS-COV-2 Detection Kit for the VERSA Viral Detection workstation involved in targeting genes includes ORF1ab and N gene and produces 24 tests per kit. It shows a detection limit in 200copies per mL. However, positive and negative test control is also used to monitor the test accuracy.
GNA Biosolutions GmbH: SARS-CoV-2 Detection Kit
GNA Biosolutions GmbH has developed the SARS-CoV-2 Detection Kit on a portable PCA Analyzer which comprised of an instrument and disposable test chips. The test would run on the neo system whichamplifies and detects genetic material and can be used to test eight samples at a time. Moreover, it can also provide analysis within 15-25 minutes.
FluroTest LLC:CompleTestPlatform Technology
FluroTest LLC uses the CompleTestplatform technology to test for a range of viruses including COVID-19, as well as accurately determining the viral load. Additionally, FluroTest ‘s technology can be adapted to allow for the detection of specific anti-SARS-CoV-2 human antibodies in blood samples, potentially confirming the development of immunity. Once developed, both tests would be administered at point-of-collection with results expected to be available in less than 15 minutes.
Attomarker Ltd: Immuno-Kinetic Assay for Covid-19
Attomarker Ltd has Developed the Quantitative Immuno-kinetic assay for Covid-19 IgG+IgM+IgA for a multiantigen panel with CRP (automated) which relies on detecting virus RNA in a swab sample from the patient’s throat or nose. It is a Portable device Attomarker Liscar which comprised of 4 bench-top instruments, each providing results in just ten minutes.
Emerging Diagnostic Products Landscape for Novel Coronavirus (COVID-19)
Company Name/ Sponsors
Product Test Type
Product Description
Academia Sinica
Anti-SARS-CoV-2 nucleocapsid protein human IgM/IgG rapid detection kit
Simple detection procedure Only 15- 20 minutes
Access Bio Korea, Inc.
CareStart COVID-19 IgM/IgG
The device is designed to amplify a total of two unique target genes of SARS-CoV-2 to improved sensitivity and with its high sensitivity
AIVD Biotech Inc.
COVID-19 IgG/IgM Rapid Test (colloidal gold-based)
Quantitative Immuno-kinetic assay for Covid-19 IgG+IgM+IgA for a multiantigen panel with CRP (automated)
It relies on detecting virus RNA in a swab sample from the patient’s throat or nosePortable Attomarker Liscar bench-top instrument, each providing results in just ten minute
Aura Biotechnologies Ltd
Quick COVID-19 Colorimetric LAMP PCR
Fast and simple yet accurate detection for coronavirusTakes 30 minutes’ assay
Aurora Biomed Inc.
SARS-COV-2 Detection Kit for the VERSA Viral Detection workstation
Target genes: ORF1ab and N gene200 copies per mL detection limitPositive and negative controls to monitor test accuracy24 tests per kit
Beijing Infervision Technology Co. Ltd
InferRead CT Pneumonia
CT-AI Based model is efficient and reliable
Canary Health Technologies
AiroStotleCV19 (Breath VOCs)
A highly sensitive, specific, non-invasive and cost-effective test using VOCs analysis as a result of oxidative stress offers a potentially powerful new approach to early diagnosis COVID-19
DNA Software, Inc.
Upper Respiratory Virus Panel, multiplex PCR, COVID-19, Influenza A B
Automated consensus design of multiple variants of DNA or RNA targets
FemtoDx
COVID-19 Antibody Test
At Home testThe test will take under 5 minutesEasy to use the device
FemtoDx
COVID-19 Rapid Home Nucleic Acid Test
At Home testThe test will take under 5 minutesEasy to use the device
FluroTest LLC
Complete Test
CompleTest platform technology to test for a range of viruses including COVID-19, as well as accurately determining the viral load.
Fluxergy LLC
Fluxergy Sample-to-Answer SARS-CoV-2 RT-PCR
A point-of-use device capable of comprehensive laboratory testing
Genedrive plc
Genedrive 96 SARS-CoV-2 Kit
The assay combines Genedrive’s PCR chemistry integrated with Cytiva’s LyoStable stabilization technology.
GNA Biosolutions GmbH
SARS-CoV-2 Detection Kit on portable PCA Analyzer
The system amplifies and detects genetic material and can be used to test eight samples at a timeProvide analysis within 15-25 minutes
AB Diagnostic Systems GmbH
abia SARS-CoV-2 Ab
The world’s easiest to use a range of diagnostic kits for HIV, hepatitis A, B, C, D, E infections, SARS-CoV-2 (COVID-19), prenatal diagnostics (TORCH), hormones (thyroid, fertility), tumor markers and moreCompletely recyclable
Abwiz Bio
RabWiz Ultra Sensitive COIV-19 Viral Antigen Test Kit (ELISA)
It can play a critical role in the development of next-generation COVID-19 diagnostic toolsHighly-specific SARS-CoV-2 monoclonal antibodies
The coronavirus pandemic had created a challenge for the diagnostic companies to developed and commercialized new diagnostic products. Hence, several companies have developed various products to meet the demand for assays to detect SARS-CoV-2 coronavirus. These diagnostic test products are used only for diagnostic and clinical use.
Companies such as Altona Diagnostics, DiaCarta, DiaSorin Molecular, Quidel Corporation, PerkinElmer, etc. have received CE Mark in the European Countries.
Companies and Their Serological and PCR Oriented Diagnostic Products
PerkinElmer, Inc.: Perkinelmer
New Coronavirus Nucleic Acid Detection Kit
PerkinElmer New Coronavirus Nucleic Acid Detection kit is a real-time RT-PCR test intended for the qualitative detection of nucleic acid from SARS-CoV-2 in human oropharyngeal and nasopharyngeal swab samples. It is highly reliable to perform verified with case-studies from the outbreak’s point of origin and highly sensitive for Limit of detection of 20 copies/mL. In- addition, an automated option is also available to meet a broad range of sample throughput.
RealStar SARS-CoV-2 RT-PCR Kits (1.0 and U.S versions),
is a reagent system, based on real-time PCR technology, for the qualitative
detection and differentiation of lineage B-betacoronavirus (B-βCoV) and severe
acute respiratory syndrome coronavirus 2 (SARS-CoV-2) specific RNA. These
tests can be run in parallel: RealStar Influenza Screen & Type RT-PCR
Kit 4.0.etc.
DiaSorin Molecular LLC:Simplexa
COVID-19 Direct
Simplexa COVID-19 Direct reagents are commercially distributed as a kit to labs and can run 1 specimen at a time. It can also be run in moderate and high complexity labs
Quidel Corporation: Lyra SARS-CoV-2 Assay
Lyra SARS-CoV-2 Assay is a real-time RT-PCR test intended for the qualitative detection of nucleic acid from SARS-CoV-2 in a nasopharyngeal or oropharyngeal swab. It is ready to use assay.
DiaCarta, Inc:Quantivirus
SARS-Cov-2 Test Kit
QuantiVirus SARS-CoV-2 Test kit is based on Real-Time PCR technology, developed for specific detection of SARS-CoV-2 (COVID-19) viral RNA extracted from nasopharyngeal swabs, oropharyngeal swabs, and sputum. It can also detect three genes, Orf1ab, N and E genes, and different SARS-CoV-2 virus strains. Moreover, its Sensitivity is 100 copies per mL and within less than 2 hours it gives results by using qPCR machines
CE Marked Diagnostic Products for Coronavirus Outbreak in Europe
Company/ Organization
Test Name
Europe Regulatory Status
Technology
3D Medicines
SARS-CoV-2 and Influenza A & B RT-qPCR Detection Kit
CE mark 3/2020
PCR
Altona Diagnostics
RealStar SARS-CoV-2 RT-PCR Kits (1.0 and U.S versions)
